ID: 916428724

View in Genome Browser
Species Human (GRCh38)
Location 1:164707306-164707328
Sequence GAGAGCACTGAGTAAGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916428720_916428724 -5 Left 916428720 1:164707288-164707310 CCACAGGAGGCCAGGAAGGAGAG 0: 1
1: 1
2: 7
3: 68
4: 573
Right 916428724 1:164707306-164707328 GAGAGCACTGAGTAAGCCAGGGG 0: 1
1: 0
2: 3
3: 15
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916428724 Original CRISPR GAGAGCACTGAGTAAGCCAG GGG Intronic
900206416 1:1433714-1433736 GAGAGCATGGGGTCAGCCAGAGG - Intergenic
900398431 1:2462775-2462797 GGGAGCACAGAGTAAGGCAAGGG - Intronic
901241176 1:7694585-7694607 GAGAGCATTGCTTGAGCCAGGGG - Intronic
901452156 1:9342434-9342456 GAGAGCACGGAGGATCCCAGTGG + Intronic
901832045 1:11898670-11898692 GAGAGCAGGGAGGCAGCCAGAGG - Intergenic
902179465 1:14676992-14677014 GAAAGGACTGAGTAAGCTATAGG + Intronic
903027295 1:20438464-20438486 GTGAGCAATAAGGAAGCCAGAGG - Intergenic
904052004 1:27645471-27645493 GAGTGCAGTGAGGAAGCCAGTGG + Intergenic
904297233 1:29527911-29527933 GAGATCACTGAAACAGCCAGGGG - Intergenic
904450818 1:30610138-30610160 GAGAGCACTCAGGGAGACAGGGG - Intergenic
904616309 1:31752113-31752135 GAGAGCACTAACTAGGACAGTGG - Intronic
906286376 1:44590451-44590473 GAGAGCTCTGAGGAAGCATGGGG - Intronic
906742890 1:48199536-48199558 GAGAGCTCAGAGTAAGGGAGTGG + Intergenic
907751715 1:57269401-57269423 GAGACCACAGGGTAAACCAGTGG - Intronic
908644620 1:66264153-66264175 GAGAGCACAGAGCCAGTCAGTGG + Intronic
908936153 1:69378468-69378490 TAGAGGACTAAGAAAGCCAGTGG - Intergenic
909510265 1:76444839-76444861 GAGGGTACAGAGTAAGCCTGGGG - Intronic
910877154 1:91887821-91887843 GAGAGCCCTGAGTCAGGCATTGG + Intronic
911642818 1:100306933-100306955 GAGAGCACTCAGGAAGCCAGAGG + Intergenic
912699181 1:111863829-111863851 AAGACAACTGAGTAATCCAGGGG + Intronic
916428724 1:164707306-164707328 GAGAGCACTGAGTAAGCCAGGGG + Intronic
916585228 1:166144261-166144283 GAGAGCTGTGAGTAAGGCTGGGG + Intronic
917456559 1:175191039-175191061 CAGGGCACTGACTAATCCAGGGG - Intronic
917787706 1:178476782-178476804 GAGAACACAGTGAAAGCCAGGGG - Intronic
918410790 1:184256024-184256046 GTGAGAAATGAGTAAGCCAAAGG - Intergenic
920679452 1:208061273-208061295 GAGAGCACTTTGGAAACCAGAGG + Intronic
921157619 1:212450486-212450508 GAGAGGCCTGAGCAAGCCAGTGG + Intergenic
921575936 1:216834873-216834895 GAAAGCACTGAGACAGTCAGCGG + Intronic
921874422 1:220177858-220177880 GAGAGAACTGAGAAAGACAAAGG + Intronic
923618564 1:235558074-235558096 GACAGGACTCAGCAAGCCAGAGG - Intronic
1062782527 10:228107-228129 GGGAACACTGATAAAGCCAGAGG + Intronic
1065103120 10:22351485-22351507 GAGAGCAGTCAGTAAGTCACAGG - Intronic
1065484241 10:26221806-26221828 GAGCGCACTGCGTCAGCCATTGG - Intronic
1067163950 10:43849897-43849919 GAGAGAACTGAATAGACCAGAGG - Intergenic
1068912003 10:62388542-62388564 GAGATCACGGACAAAGCCAGAGG - Exonic
1069569781 10:69487312-69487334 GAGAGCACACAGCAAGGCAGAGG + Intronic
1070462430 10:76683338-76683360 GAGAGCACTGACTAATACAGTGG + Intergenic
1070957345 10:80473247-80473269 GACAGCACTGAGGTAGACAGAGG + Intronic
1071985466 10:91045909-91045931 GAGAGCAAAGAGGAAGCCAGAGG + Intergenic
1072621980 10:97085942-97085964 CAGAGCACTGACAACGCCAGTGG + Intronic
1073020438 10:100439058-100439080 GAGAGCACAGAGGAAGGGAGGGG - Intergenic
1073114336 10:101082814-101082836 GATAGCCCTGGGAAAGCCAGAGG - Intergenic
1073960009 10:108914730-108914752 GAGGGCACTTAGTAAGCCAATGG - Intergenic
1074365835 10:112856759-112856781 GAGAACACTGACTAATACAGAGG - Intergenic
1074726546 10:116315952-116315974 CAGAGCAGAGAGGAAGCCAGTGG - Intergenic
1077461961 11:2715259-2715281 GAGAGCAGAGAGTCAGACAGAGG - Intronic
1079060699 11:17246348-17246370 AAGAGTACTGAGTGAGGCAGAGG - Intronic
1080745058 11:35101277-35101299 GAGTGCACAGAGGAAGCCATGGG - Intergenic
1081369978 11:42288441-42288463 GAGAGCAGAGAGTAAAACAGTGG + Intergenic
1082161067 11:48888511-48888533 GAGAGCACTTTGAAAGCTAGAGG - Intergenic
1082242006 11:49883416-49883438 GAGAGCACTTTGTAAGCTGGAGG + Intergenic
1083322195 11:61854677-61854699 GAGAGCAGAGAGTTAGCCACAGG + Intronic
1084176017 11:67422758-67422780 GAAAACACTGAGCAAGGCAGGGG - Intronic
1084195728 11:67522951-67522973 AAGGCCACTGAGAAAGCCAGCGG + Intronic
1091351573 11:134901752-134901774 CAGAGCACGGAGCAGGCCAGCGG - Intergenic
1093757269 12:22866682-22866704 GAGTGAACTGAATAAGGCAGTGG - Intergenic
1096602551 12:52740315-52740337 GAGAGCACTGAGGATGGCTGGGG + Intergenic
1097320186 12:58216912-58216934 GAGAACCCTGAGTAAGACAGAGG + Intergenic
1098796143 12:74890304-74890326 CAAATCTCTGAGTAAGCCAGAGG + Intergenic
1100635063 12:96427378-96427400 GAGAGCAGTGAGGAAGGAAGGGG + Intergenic
1100716685 12:97313456-97313478 CAGAGCACTGTGTAAGAAAGTGG + Intergenic
1102193019 12:111003118-111003140 GAAGGTAGTGAGTAAGCCAGGGG - Intergenic
1106286771 13:28324730-28324752 CAGAGCCCTGAGTGAGCCTGTGG - Intronic
1107343354 13:39433495-39433517 AAAAGCACCGATTAAGCCAGAGG + Intronic
1110296520 13:73872610-73872632 GAGAGCACCTAGGAAGCCACTGG + Intronic
1110843785 13:80171237-80171259 AAGATCACTGATTATGCCAGGGG - Intergenic
1114672923 14:24422033-24422055 GAGACCACAGATTAAGCGAGGGG - Intergenic
1118513997 14:66507596-66507618 GAGCCCACTGAGGAAGCCAGCGG + Exonic
1118923722 14:70172810-70172832 GAGGGCACTGAGCCAGCCTGGGG + Intronic
1121833728 14:97073736-97073758 GAGAGCCCTGAGCGAGCGAGAGG + Intergenic
1122502776 14:102212376-102212398 GAGAGCACTGTGCCAGCCTGGGG + Intronic
1123099200 14:105784282-105784304 GAGAGCACTGAGTGCATCAGAGG - Intergenic
1123187138 14:106530824-106530846 GGGGGCACTGAGGAAACCAGGGG - Intergenic
1124231161 15:27947463-27947485 GAGAGCCCTGAGGGACCCAGGGG - Intronic
1127731649 15:61807570-61807592 GAGCGTAATGAGTTAGCCAGTGG + Intergenic
1128659247 15:69485818-69485840 GAGAGCAATGACTGAGCCATAGG + Intergenic
1128787076 15:70405565-70405587 GAGATCACTAAGCAAGCCAATGG + Intergenic
1130276204 15:82477500-82477522 GAGGCCACTGGGTGAGCCAGGGG + Intergenic
1130468563 15:84204893-84204915 GAGGCCACTGGGTGAGCCAGGGG + Intergenic
1130485190 15:84394869-84394891 GAGGCCACTGGGTGAGCCAGGGG - Intergenic
1130590856 15:85209492-85209514 GAGGCCACTGGGTGAGCCAGGGG + Intergenic
1131188506 15:90294721-90294743 GAGGCCACTGGGTGAGCCAGGGG - Exonic
1131266458 15:90918326-90918348 CAGGGCAGTGAGGAAGCCAGAGG - Exonic
1131618467 15:94041941-94041963 GAAAGTACTGGGTCAGCCAGAGG + Intergenic
1132153728 15:99480555-99480577 GAGAGGGCTGGGCAAGCCAGGGG - Intergenic
1133854693 16:9538704-9538726 GAGAGCACAGAATAAGCCAGGGG + Intergenic
1134520551 16:14917488-14917510 CAGAGCCCTTAGTAGGCCAGAGG - Intronic
1134551023 16:15138486-15138508 CAGAGCCCTTAGTAGGCCAGAGG + Intronic
1134708223 16:16316139-16316161 CAGAGCCCTTAGTAGGCCAGAGG - Intergenic
1134715438 16:16356172-16356194 CAGAGCCCTTAGTAGGCCAGAGG - Intergenic
1134951379 16:18352506-18352528 CAGAGCCCTTAGTAGGCCAGAGG + Intergenic
1134959319 16:18395987-18396009 CAGAGCCCTTAGTAGGCCAGAGG + Intergenic
1137830207 16:51536983-51537005 AAGGGCACTCAGCAAGCCAGTGG + Intergenic
1138294802 16:55876974-55876996 TAGGGCACTGAGTCAGTCAGGGG + Intronic
1139968486 16:70758958-70758980 GAGACAACTGAGGATGCCAGAGG + Intronic
1141329753 16:83099842-83099864 GAGAGCACTCAGTAAGAGTGAGG + Intronic
1142474443 17:180943-180965 GAGCGCACCGAGTGCGCCAGGGG + Intronic
1143581908 17:7832706-7832728 CACAGCAGTGAGGAAGCCAGTGG - Exonic
1147288752 17:39424379-39424401 GGGGGCACTCATTAAGCCAGAGG + Intronic
1148738571 17:49879228-49879250 AAGACCACTGGATAAGCCAGTGG - Intergenic
1150355082 17:64476092-64476114 AATAGCACTGAGTTGGCCAGTGG - Intergenic
1150621828 17:66813427-66813449 CAGAGCACACAATAAGCCAGGGG - Intergenic
1151528503 17:74688091-74688113 GAGCACACTGACTAAGCCTGAGG + Intronic
1152019087 17:77771197-77771219 GTGAGCCCTGAGCAAGGCAGAGG + Intergenic
1152086137 17:78219945-78219967 CAGAGCGCTGAGAAAGACAGAGG + Intronic
1155888223 18:31234248-31234270 GAGAGCAGGGACTGAGCCAGTGG + Intergenic
1157479581 18:48044831-48044853 GTGAGGACTGAGTAAGCCTAAGG - Intronic
1159197488 18:65136849-65136871 CTGAGAACTGAGGAAGCCAGTGG + Intergenic
1161039627 19:2103322-2103344 GAGGGCCCTGAGGCAGCCAGAGG + Intronic
1165475364 19:36027107-36027129 GAGAACACTGGGGAAACCAGGGG - Intronic
1166457301 19:42952582-42952604 GCAATCACGGAGTAAGCCAGTGG + Intronic
1166855954 19:45782696-45782718 TAGAGCACAGAGGAAGCCACAGG + Intronic
925824906 2:7838401-7838423 GAGAACACTGACTAATACAGTGG + Intergenic
926178080 2:10615041-10615063 GAGAACACTGGGTGAGCCAGAGG + Intronic
927716978 2:25359460-25359482 GGGGGCTCTGAGCAAGCCAGCGG + Intergenic
929771971 2:44900033-44900055 GAGATCCGTGCGTAAGCCAGAGG - Intergenic
932279176 2:70474696-70474718 AAGAGCACTGTGTAGCCCAGAGG - Intronic
932411981 2:71552986-71553008 GAGAGCAGAGAGTAGACCAGAGG - Intronic
934659645 2:96136423-96136445 GAAAGCACTGGGTAAGGCACGGG + Intronic
934672061 2:96220428-96220450 GAGAGCCCTGACTAAAGCAGTGG + Intergenic
937957594 2:127430366-127430388 GAGAACCCTGACTAATCCAGGGG + Intergenic
940000404 2:148961667-148961689 GAGAACACAGACTAAGACAGTGG + Intronic
940515892 2:154683728-154683750 TAGAGTACTGAGGAAGCCTGGGG + Intergenic
942523889 2:176832496-176832518 AAGAGCACAGAGCAGGCCAGTGG - Intergenic
944398666 2:199300037-199300059 TAGAGCAATGAGAAAGACAGAGG - Intronic
946489117 2:220130716-220130738 TGGAGGACTGAGTAAGCCAAGGG + Intergenic
948321495 2:237073360-237073382 GAGAGCTCTGAGTAAGCAGAAGG + Intergenic
948625132 2:239263982-239264004 GTGTGCCCTGAGTAAGCCACTGG - Intronic
1169284742 20:4298551-4298573 GAGAGGACTGAGTCAGAGAGGGG - Intergenic
1171210590 20:23313516-23313538 GAGAGCACAGAGCAAGGGAGTGG + Intergenic
1172356253 20:34282189-34282211 GAGAGCAAGGAGGAAGCCACAGG - Intronic
1173044327 20:39494930-39494952 GATAGCACAGAGTAAGCAACGGG + Intergenic
1173841059 20:46157649-46157671 GAGAGCAATGCTTAACCCAGAGG + Intergenic
1173880004 20:46405445-46405467 GAGAGCACTGAGCAAGCGGACGG + Intronic
1176298846 21:5088936-5088958 GACAGCACTGACTGGGCCAGTGG - Intergenic
1179858180 21:44173013-44173035 GACAGCACTGACTGGGCCAGTGG + Intergenic
1182927534 22:34139631-34139653 GAGAGCATAAAGGAAGCCAGAGG - Intergenic
1183256629 22:36766605-36766627 GAGGTCACTGAGTAGGCCTGGGG + Intronic
1184640313 22:45866950-45866972 GAGGGCCCTGAGGAAGCCGGCGG + Intergenic
1185052654 22:48561962-48561984 GAGAGCACTCAGGGAGCCTGAGG - Intronic
950146954 3:10656915-10656937 CAGAGGACAGAGTCAGCCAGGGG + Intronic
950506155 3:13395918-13395940 GTGAGTACTCAGTAAGCCAGGGG - Intronic
952637357 3:35548150-35548172 GAGACCAGTGAGAAACCCAGAGG + Intergenic
953368348 3:42366348-42366370 GTGAGCACTGAGTGGGCCTGAGG + Intergenic
954211833 3:49102099-49102121 CAGGGTACTGAGTAAGCCAAGGG + Intronic
954689973 3:52390601-52390623 GTGAGCACTCAGTAGGCAAGAGG + Intronic
954791567 3:53137086-53137108 GCCAGCCCTGAGTATGCCAGGGG - Intergenic
955041758 3:55324264-55324286 AAGAACACTGAGTAAGCCAAAGG - Intergenic
955414702 3:58681273-58681295 GAGAGCACAGGGAAAGACAGCGG - Intergenic
957708053 3:83815625-83815647 GAGAGCAGTGAGTACAACAGTGG + Intergenic
959525700 3:107373857-107373879 AAGAGCACTGAGTTAGTCATGGG + Intergenic
961184473 3:124902614-124902636 GAGAGTACTGGGGTAGCCAGAGG + Intergenic
961582263 3:127892431-127892453 GAGAGCATTTACAAAGCCAGTGG - Intergenic
962343208 3:134602135-134602157 GGGGGCACTGAGACAGCCAGGGG + Intronic
962345598 3:134616944-134616966 GAGAGCACTGAGGCTGCAAGAGG + Intronic
962433933 3:135347266-135347288 GAGAAGACTGAATCAGCCAGAGG - Intergenic
966871465 3:184292630-184292652 GTGCGCACTGAGTGAGCCTGGGG - Exonic
968207485 3:196816835-196816857 GAGAGCACTGAGTCACAAAGTGG - Intronic
969081737 4:4624459-4624481 CAGAGCACTGAGCAGGCTAGTGG + Intergenic
971143025 4:23945659-23945681 CACAGCACTGAGGAAGCCAGGGG + Intergenic
971992569 4:33918748-33918770 GAGAGAACTCAGTCAGGCAGAGG + Intergenic
974152902 4:58032353-58032375 GAGAGAACTGAGTAAGCAAGTGG - Intergenic
975303124 4:72815249-72815271 AAAATCACTGAGTAATCCAGTGG + Intergenic
975553794 4:75639813-75639835 GAATGAACTGAATAAGCCAGTGG + Intergenic
975776495 4:77793167-77793189 GAGAGAAATGAAAAAGCCAGAGG + Intronic
978337931 4:107689472-107689494 GAGAACCCTGAGAAAGCAAGGGG - Intronic
981628341 4:146787695-146787717 GTGGGCACTGAGGCAGCCAGTGG + Intronic
982137068 4:152281895-152281917 GAGAGAAGAGAGAAAGCCAGAGG + Intergenic
982234969 4:153243652-153243674 GAGAGCCCTTACTAAGTCAGAGG + Intronic
983143212 4:164179129-164179151 ATGAGCACTGAGTTTGCCAGGGG + Intronic
984134698 4:175921384-175921406 TAGAGCACTGAAAAAGACAGTGG + Intronic
984343559 4:178490442-178490464 GAGAGGGCTGAGTGAGACAGTGG + Intergenic
985178745 4:187232928-187232950 GAGAGCAGTGAAAAAGCCACTGG - Intergenic
986412140 5:7491971-7491993 CACAGCACTGAGTAACACAGGGG + Intronic
986758155 5:10856736-10856758 GAAAGCACTCAGCAAGCCTGGGG - Intergenic
987230847 5:15892120-15892142 CAGAGCACAGAGAAAGCCTGGGG + Intronic
987428512 5:17801816-17801838 GAGAGCACTGAGCAACACAATGG - Intergenic
988412500 5:30905134-30905156 GAGAGCACTGTTTAACCCTGAGG + Intergenic
988877936 5:35468976-35468998 GAGAGGACAGAGGATGCCAGAGG - Intergenic
988951330 5:36264657-36264679 GACAGCAATGAGGGAGCCAGGGG - Intronic
989061270 5:37414278-37414300 GAGAGGAGTGAGCAAGCCAGGGG - Intronic
990507183 5:56456239-56456261 GAGAGCAGTGAGTCAGCGAAGGG - Intergenic
997566960 5:134895392-134895414 AAGAGCACTGAGTATGCCTGGGG - Intronic
997869089 5:137491083-137491105 GGGAGGACTGAGTAAGCACGTGG - Intronic
998324253 5:141265169-141265191 GAGAACACTGTGAAAGCCAAAGG - Intergenic
998481334 5:142465721-142465743 GACAGCACATAGTAAGCAAGAGG - Intergenic
998890957 5:146745235-146745257 AAGAACACTGGGTCAGCCAGTGG + Intronic
999241540 5:150130672-150130694 GAGAGCACTGAGTTAGGAGGCGG + Intronic
999424123 5:151472054-151472076 GAGAACCCTGACTAAGACAGAGG - Intronic
1001206294 5:169766364-169766386 CAGAGCACTGATGAAGCCAGAGG - Intronic
1002446026 5:179290690-179290712 GAGAGCACTGAGGGAGGCTGGGG - Intronic
1005216536 6:23534608-23534630 CAGTGCCCTGAGTAAGCCACGGG - Intergenic
1006467338 6:34203453-34203475 GAGAGGACTCAGGAAGCCAAAGG + Intergenic
1010214435 6:73389124-73389146 GGGAGCTTTGAGGAAGCCAGAGG + Intronic
1011549712 6:88519905-88519927 GAGAACACTGAGTGAGCTGGTGG - Intergenic
1012561956 6:100593164-100593186 AAGCGTACTGAGAAAGCCAGCGG + Intronic
1014411262 6:121124622-121124644 GAGAGAACTGAGAAAGACAAGGG - Intronic
1017406781 6:154127877-154127899 CAGAGCACTGGGTGAGCCTGGGG - Intronic
1017646334 6:156542961-156542983 CAGAGTAGTGAGTAATCCAGTGG - Intergenic
1017761790 6:157574910-157574932 GAGAGCACTGAATAATACAGAGG - Intronic
1018110611 6:160533921-160533943 GAGAGCACTGAGAAATCCCTGGG - Intronic
1018212312 6:161494203-161494225 CATTGCACTGAGTAACCCAGTGG - Intronic
1020212458 7:6166772-6166794 GGCAGCACTGAGTGAGGCAGGGG - Intronic
1020700708 7:11478814-11478836 AAGAACACTGAGTAAATCAGGGG + Intronic
1022227989 7:28383134-28383156 GAGACCAATGAGCATGCCAGTGG + Intronic
1023302551 7:38789368-38789390 GAAAGCACTGGGAAAGCCACTGG - Intronic
1028827081 7:95286152-95286174 GAGTGCAGTGAGTGAGCAAGAGG - Intronic
1032316839 7:130845655-130845677 GAGAGCAGTGGGCAAGCCTGGGG - Intergenic
1032825857 7:135567244-135567266 GAGAGGACGGACTAAACCAGTGG - Intronic
1034265368 7:149778048-149778070 GAGAGCACTGGGAGAGCAAGAGG + Intergenic
1037675840 8:21050156-21050178 GAGAGGAAGGAGTAAGCCACAGG - Intergenic
1040465767 8:47693670-47693692 GGCAGCACTAACTAAGCCAGAGG + Intronic
1046234288 8:111402637-111402659 GAGATCACAGGGCAAGCCAGGGG + Intergenic
1047003571 8:120596761-120596783 GAGAGCACAGAGAAAGACACAGG - Intronic
1047790449 8:128198350-128198372 CAGAGCACTGAGCATACCAGCGG + Intergenic
1048739225 8:137536099-137536121 AAAAGCGCTGAGTCAGCCAGAGG - Intergenic
1049196347 8:141317902-141317924 GAGAGCAATGCTAAAGCCAGAGG + Intergenic
1049296815 8:141845180-141845202 CAGGGCACAGAGGAAGCCAGCGG + Intergenic
1049975693 9:859438-859460 GAGAGCACTGAGAGCCCCAGGGG - Intronic
1053280209 9:36815710-36815732 AAGATCACAGAGTGAGCCAGAGG - Intergenic
1054821136 9:69521473-69521495 CAGAACAGTGAGCAAGCCAGAGG + Intronic
1056041562 9:82672990-82673012 AAGATCACAGGGTAAGCCAGAGG - Intergenic
1056844581 9:90025985-90026007 TAGAGCTGTGAGTAAGCAAGAGG + Intergenic
1057886688 9:98834961-98834983 GAGAACACTGAGGAGGGCAGGGG - Intronic
1057906839 9:98989896-98989918 GAAAGCACTGAGTCAGACTGTGG + Intronic
1058916813 9:109575308-109575330 TGGAGAACTGAGAAAGCCAGTGG - Intergenic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1061480816 9:130897010-130897032 GGGAGCACTGAGGCACCCAGAGG - Intergenic
1185813928 X:3136454-3136476 CAGAGCACTGATGGAGCCAGCGG - Intergenic
1186402565 X:9273304-9273326 GGATGCACTGATTAAGCCAGGGG + Intergenic
1186793544 X:13022621-13022643 GAGACCACAGAGCAAGGCAGGGG + Intergenic
1195164964 X:102210210-102210232 GAGAGCCCTCAGCAAGCCACTGG - Intergenic
1195193894 X:102476881-102476903 GAGAGCCCTCAGCAAGCCACTGG + Intergenic
1198327086 X:135584743-135584765 GGGAGCAGTAAGTATGCCAGGGG - Intergenic
1198863984 X:141101172-141101194 CAGAGGTCTTAGTAAGCCAGTGG - Intergenic
1198898705 X:141486243-141486265 CAGAGGTCTTAGTAAGCCAGTGG + Intergenic
1201269208 Y:12238082-12238104 TAGAGAACTGAGGAAGACAGAGG + Intergenic
1202372925 Y:24210421-24210443 GAGGCCACTGGGTGAGCCAGGGG + Intergenic
1202497857 Y:25459699-25459721 GAGGCCACTGGGTGAGCCAGGGG - Intergenic