ID: 916432432

View in Genome Browser
Species Human (GRCh38)
Location 1:164744004-164744026
Sequence CTAGGTAACTAGAAGTCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916432429_916432432 6 Left 916432429 1:164743975-164743997 CCAAGGAGGAAAGGTAGAATGGA 0: 1
1: 0
2: 2
3: 30
4: 332
Right 916432432 1:164744004-164744026 CTAGGTAACTAGAAGTCTGATGG 0: 1
1: 0
2: 1
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916432432 Original CRISPR CTAGGTAACTAGAAGTCTGA TGG Intronic
906634995 1:47403521-47403543 CAAGGGAACTGGAAGTCTAAAGG + Intergenic
914915934 1:151819221-151819243 CTAAGTGACTAGAAGTATGGGGG - Intronic
916432432 1:164744004-164744026 CTAGGTAACTAGAAGTCTGATGG + Intronic
920113222 1:203601484-203601506 CTAGGTAACTAGCAATTTGTGGG + Intergenic
1068253560 10:54476718-54476740 AAAGGTTTCTAGAAGTCTGAAGG - Intronic
1071619421 10:87105581-87105603 TTATCTAACAAGAAGTCTGAAGG + Intronic
1074917113 10:117968417-117968439 CTAGGTCATTGGAAGCCTGAGGG - Intergenic
1076063254 10:127429601-127429623 CTGGGTATCGAGAAGTCAGAGGG - Intronic
1077046837 11:550411-550433 CTCTGTCACTGGAAGTCTGACGG + Intronic
1081108824 11:39106546-39106568 CCTGGAAACTAGAAATCTGAGGG + Intergenic
1084167918 11:67385201-67385223 CAGGGTAACTAAAAGTCAGAAGG - Intronic
1086858628 11:91897906-91897928 CTTGGAAACTTGAAGACTGAAGG - Intergenic
1091401463 12:183273-183295 ATAGGTAATTACAAGTCTTAGGG + Intergenic
1096800616 12:54108074-54108096 CTGGGTACCTAGAAGTCTCTAGG + Intergenic
1099923088 12:88983517-88983539 CTCAGTGACTAGAAGTTTGATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105807591 13:23965255-23965277 ATAGGTAAATAGAAGTATAAAGG - Intergenic
1106279302 13:28249787-28249809 CTAGATAACTAAAACACTGAAGG - Intronic
1106969471 13:35120914-35120936 CTAGGTATGTAGATGTGTGATGG + Intronic
1107454325 13:40540272-40540294 CTAAGTGACTAGATGTGTGAAGG - Intergenic
1107527861 13:41251155-41251177 CTAAGTAACTAGATGTGAGAGGG - Intronic
1109183647 13:59244699-59244721 CTAGCTACGTAGATGTCTGAGGG + Intergenic
1110392500 13:74991372-74991394 CTAGGTAAGTAGAGGACTCAGGG - Intergenic
1113087512 13:106583331-106583353 CTATGTAACAAGAAATCAGAAGG - Intergenic
1118185363 14:63532944-63532966 CTAGGTACTTGGAAGGCTGAGGG - Intronic
1129550543 15:76444204-76444226 TTAGGAAACAAGAAGTCAGAAGG - Intronic
1129916514 15:79278340-79278362 CTGCATAACTAAAAGTCTGAAGG - Intergenic
1137389137 16:48067025-48067047 CCAGGCAACAAGAAGTGTGAAGG + Intergenic
1140080168 16:71738738-71738760 CTAGGTTACAAGTATTCTGATGG - Intronic
1141073622 16:80981456-80981478 GTAGGTAACTAAAACTCTCAGGG - Intronic
1150734085 17:67720847-67720869 CTAGCTAGCTAGAAGTTTCAAGG - Intronic
1151041631 17:70868258-70868280 CTAGGGAAGTAGAAGTCAGGAGG + Intergenic
1154489885 18:14913212-14913234 CTGGGTAACTAAAAGGCTGTAGG - Intergenic
1155801637 18:30112470-30112492 CTAGGTAACTACAAATGGGATGG - Intergenic
1157943513 18:51954643-51954665 CTAGATCACCAGAAGTCAGACGG - Intergenic
1158341176 18:56468224-56468246 CTAGGTAATCAGCAGTCTCATGG + Intergenic
1168565990 19:57424225-57424247 GTAGGAAACAAGAAGTCAGAAGG + Intronic
929553359 2:42908111-42908133 ATAGGTAAGGAGAAGTCTGCTGG + Intergenic
929836850 2:45410261-45410283 CAAGGTAACCAGAATTCTCATGG + Intronic
930414725 2:51077067-51077089 CTGGGCAACTAGAAGGCTGTGGG + Intergenic
938991153 2:136631355-136631377 GTAGGTCAGTAGAAGGCTGAGGG + Intergenic
942665079 2:178308930-178308952 GTAGGTAACAATGAGTCTGATGG - Intronic
944130791 2:196345614-196345636 CTAGGTAGCAAGAAGCCTGAAGG - Intronic
948287948 2:236801583-236801605 CAAGGTAACGAGATGTGTGATGG + Intergenic
1169741800 20:8902885-8902907 CTAGGTACTTAGGAGGCTGAGGG + Intronic
1171852395 20:30317875-30317897 CTGGGTACCTAGAAGTCTCTAGG + Intergenic
950262651 3:11553943-11553965 CTAGGAATTTGGAAGTCTGAAGG + Intronic
950382516 3:12628864-12628886 CTAGCTACCTAGGAGGCTGAAGG - Intronic
954633840 3:52060983-52061005 CTAGGTGACTAGAGGGCTGAGGG - Intergenic
955879289 3:63526666-63526688 CTAAGTAAATAGAAGCCTAAGGG + Intronic
958597255 3:96242876-96242898 ATATATAACCAGAAGTCTGAGGG - Intergenic
960475264 3:118116878-118116900 CCAGGAAACTAGGAGTCTGCAGG + Intergenic
965983711 3:174725363-174725385 CTAGGTAAATAAAAGTGGGATGG - Intronic
966591065 3:181683423-181683445 CAAGGAAACAACAAGTCTGAAGG - Intergenic
967246448 3:187491652-187491674 CTAGTTAACTAGAATGCTGCAGG - Intergenic
971826056 4:31623916-31623938 CTATGTCACTAGAACTCTGAGGG + Intergenic
975062989 4:70026410-70026432 CTAGCTATTTAGGAGTCTGAGGG + Intergenic
976210991 4:82669581-82669603 CTAGGTATGGACAAGTCTGAAGG + Intronic
978240810 4:106514211-106514233 CTAGGAAAATAGGAGTCTGGTGG + Intergenic
979227818 4:118309746-118309768 CTAGGGAGGTAGAAGTCTGCAGG + Intronic
984846292 4:184110767-184110789 CCACATAACTAGAAGTCTGGAGG - Intronic
988495254 5:31739762-31739784 TTAGGAAACAAGAAGTCAGAAGG + Intronic
988540917 5:32108510-32108532 TCAGGGAACTAAAAGTCTGAGGG + Exonic
989117017 5:37964915-37964937 CTAGGTAATAAGCAGTCTGGAGG + Intergenic
991009746 5:61870546-61870568 TTAGGTGAATAGAAGTTTGAGGG - Intergenic
991184544 5:63792141-63792163 CTAGGTTACCAGCACTCTGAGGG + Intergenic
991273787 5:64819309-64819331 CTAGGTAAATACATGTCAGAGGG - Intronic
991442566 5:66666318-66666340 CTAGCTGACTGGAAGTCTGGAGG - Intronic
996614313 5:125422181-125422203 CTAGATAACTAGCACACTGACGG - Intergenic
997361250 5:133296533-133296555 CTAGGTAAAAATAGGTCTGATGG - Intronic
998251489 5:140556548-140556570 CTGGGTAACGAGGTGTCTGAGGG - Intronic
998859036 5:146425136-146425158 TCATGTAACAAGAAGTCTGAAGG + Intergenic
1000764257 5:165266138-165266160 CTGCTTAACTGGAAGTCTGATGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004228064 6:13805556-13805578 CTAGGCAACTAGAAGTCTGCAGG + Intronic
1012112653 6:95256862-95256884 GTAGGTAACAAGAGGTCTGGTGG - Intergenic
1023466093 7:40456719-40456741 CTAGCCAACTAGATGTCTGGTGG + Intronic
1030474236 7:110008563-110008585 CTTGGCATCTAGAAGTCAGAGGG + Intergenic
1030939760 7:115631438-115631460 CTAGGTAGCTAGAATTAGGATGG + Intergenic
1032415159 7:131730016-131730038 TAAGGTAACTGGAAGTCTTATGG + Intergenic
1032825160 7:135561582-135561604 CTCTGTGACTAGAAGTCTGAGGG - Intronic
1034876396 7:154728441-154728463 TTAAATAACTAGAAGTCAGAGGG + Intronic
1038090605 8:24248805-24248827 CTTGGTACCTTCAAGTCTGAGGG + Intergenic
1039268489 8:35854668-35854690 CTAGGTACCTAGGAGTATTATGG - Intergenic
1041461694 8:58118632-58118654 CTTTGTAACTAAAAGTGTGAAGG - Intronic
1047542901 8:125787611-125787633 CTAGGAAACTAGAACTCATAAGG - Intergenic
1048593537 8:135843656-135843678 CTACCTAGCTAGAAGGCTGATGG - Intergenic
1050804623 9:9658199-9658221 CCAGGAAACTAAAACTCTGATGG + Intronic
1053790180 9:41681153-41681175 CTGGGTACCTAGAAGTCTCTAGG + Intergenic
1054154958 9:61633604-61633626 CTGGGTAGCTAGAAGTCTCTAGG - Intergenic
1054178521 9:61892842-61892864 CTGGGTACCTAGAAGTCTCTAGG + Intergenic
1054474749 9:65564712-65564734 CTGGGTACCTAGAAGTCTCTAGG - Intergenic
1054659008 9:67687982-67688004 CTGGGTACCTAGAAGTCTCTAGG - Intergenic
1058233080 9:102454933-102454955 ACAGGTAAGTAGAAGGCTGAAGG + Intergenic
1185969329 X:4644576-4644598 GAAGGTAAATAGAATTCTGATGG + Intergenic
1187307961 X:18114258-18114280 CTAGGTCACTACAACTGTGATGG + Intergenic
1188851446 X:35137562-35137584 CTAGAAAACTAGAATTCTTAAGG + Intergenic
1192551802 X:72060626-72060648 CTAGGTAACCAGGGGTCCGAAGG - Intergenic
1201702194 Y:16896247-16896269 TCAGGTAACAAGAAGACTGAAGG - Intergenic
1201951872 Y:19574041-19574063 CCAGGTAGCTTGAAGTGTGAAGG + Intergenic