ID: 916434399

View in Genome Browser
Species Human (GRCh38)
Location 1:164763783-164763805
Sequence AAGCAACAGCAACACTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 411}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916434396_916434399 2 Left 916434396 1:164763758-164763780 CCAAAGAGGAGGTGATGTACTTC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 916434399 1:164763783-164763805 AAGCAACAGCAACACTGAAAAGG 0: 1
1: 0
2: 2
3: 42
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916434399 Original CRISPR AAGCAACAGCAACACTGAAA AGG Intronic
900576876 1:3387408-3387430 AAGCAAATGCAACACCAAAATGG + Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
902062896 1:13659912-13659934 AAATAACTGCAACATTGAAATGG + Intergenic
902931112 1:19732184-19732206 GAGCAAAAGCCACACTGAGAGGG - Intronic
903336560 1:22628249-22628271 CTGAAACAGCAACCCTGAAAGGG - Intergenic
904490368 1:30855016-30855038 GACCAACACCAAGACTGAAATGG + Intergenic
904909163 1:33921242-33921264 AATCAACAGCACCACTGAACTGG - Intronic
906683261 1:47745316-47745338 AAGCAACAACAACAACAAAATGG - Intergenic
907664492 1:56422361-56422383 TAGAAACAGCAAAACTGTAATGG - Intergenic
907700781 1:56785953-56785975 CAGCAACTGCAACACAGTAAAGG + Intronic
908199722 1:61781815-61781837 AAGCAAAATCAACATGGAAAAGG + Intronic
908304224 1:62794561-62794583 AAGGAACAGCAACACAATAAAGG - Intronic
908660408 1:66428894-66428916 AACAAGCAGCAATACTGAAATGG - Intergenic
908722904 1:67145525-67145547 AACAAACAGCAACAATGCAATGG - Intronic
909414518 1:75390109-75390131 AAGAAACTGAAACACTGAACAGG + Intronic
909603576 1:77486125-77486147 AACAAACAAAAACACTGAAATGG + Intronic
909639516 1:77856537-77856559 AACAAGCAGCAAGACTGAAATGG - Intronic
911064784 1:93778548-93778570 AACCAGCAGCAGCAGTGAAAGGG + Intronic
911598169 1:99820158-99820180 AAGAAAGAGCAACAGAGAAAAGG + Intergenic
912144500 1:106775675-106775697 AAACAACAACAACAATAAAATGG + Intergenic
912231882 1:107803398-107803420 CAGCAACAGCAGTACTGAGAGGG - Intronic
912918781 1:113844619-113844641 AAGCAATAGCAGTACTGAGAGGG - Intronic
913035503 1:114961014-114961036 AACAAGCAGCAAGACTGAAATGG - Intronic
913721970 1:121605275-121605297 CAAGAACAGCCACACTGAAATGG - Intergenic
913741754 1:121852857-121852879 CAAGAACAGCCACACTGAAATGG - Intergenic
915026605 1:152836603-152836625 AAGCAACAGCACACCTTAAAGGG - Intergenic
915703094 1:157815445-157815467 TAGCAAAAGCAATTCTGAAAGGG + Intronic
915892762 1:159786660-159786682 AAGCAACAAGAAAACAGAAAGGG - Intergenic
916434399 1:164763783-164763805 AAGCAACAGCAACACTGAAAAGG + Intronic
916869224 1:168894236-168894258 AAGTAACATTAACACTAAAAGGG - Intergenic
917097016 1:171408778-171408800 AACAAGCAGCAAGACTGAAATGG + Intergenic
917226102 1:172784982-172785004 CAGCAAAAGCAGCACTAAAAGGG - Intergenic
917265178 1:173213270-173213292 AAGCAACATGAAGAATGAAAGGG - Intergenic
918003105 1:180516375-180516397 AAGCAAAAGCAACAATCCAAAGG - Intergenic
918172177 1:182008692-182008714 AACAAGCAGCAAGACTGAAATGG + Intergenic
918529931 1:185507473-185507495 AACAAGCAGCAAGACTGAAATGG - Intergenic
918769550 1:188537080-188537102 AAGCAACAACAAAAATGAAAAGG + Intergenic
921111077 1:212037344-212037366 ATGGAACACCAACACTGAAGAGG - Intronic
921457029 1:215383748-215383770 CAGCAAAAGCAATACTAAAAGGG + Intergenic
921552731 1:216557983-216558005 AAGCAAAAGCAATGCTGGAACGG + Intronic
922658206 1:227404547-227404569 AACAAGCAGCAAGACTGAAATGG + Intergenic
924329381 1:242926727-242926749 ATGCTACAGCAACACAGATACGG + Intergenic
924455776 1:244217931-244217953 CAGCACCAGGAAGACTGAAAAGG + Intergenic
924911808 1:248521655-248521677 AACCAACAACAGCTCTGAAAAGG + Exonic
1064381222 10:14843411-14843433 GAGCAACTGCACCTCTGAAAAGG - Intronic
1064774796 10:18764603-18764625 AAGCAAGAGCATCAGTGATATGG + Intergenic
1065520925 10:26571248-26571270 TCTCAACAGCAACAGTGAAAGGG - Intergenic
1065529815 10:26657491-26657513 TCTCAACAGCAACAGTGAAAGGG - Intergenic
1065557133 10:26927635-26927657 TCTCAACAGCAACAGTGAAAGGG + Intergenic
1066324473 10:34343357-34343379 AAGCAATATGAACACTGAAAGGG + Intronic
1068158315 10:53230025-53230047 AAGAAAAAGAAACACTGAGAGGG + Intergenic
1068717157 10:60200987-60201009 TAGAAACAGATACACTGAAATGG + Intronic
1068999135 10:63244049-63244071 AAGCATCAGGAACACCCAAAGGG + Intronic
1069328710 10:67264196-67264218 AAGCAGCAGCAGCTCAGAAAGGG + Intronic
1070108409 10:73459073-73459095 AAACAACAACAACAATAAAATGG + Intronic
1071056109 10:81509832-81509854 AAGTTATGGCAACACTGAAAAGG + Intergenic
1071414002 10:85424091-85424113 CAGCAGCAGCAGCAATGAAAGGG + Intergenic
1071720788 10:88143889-88143911 AAGCAAAAGCACCACTTGAAGGG - Intergenic
1072344125 10:94486450-94486472 CAGCAAAAGCAACACTAAAAGGG - Intronic
1072789504 10:98307954-98307976 AAGCATAAGGAACACTGAGAAGG - Intergenic
1074636227 10:115321092-115321114 AAGCAACAACAACAAAAAAAAGG - Intronic
1076449302 10:130545204-130545226 AAGCAACAGCAACACTTACTGGG + Intergenic
1077297248 11:1832028-1832050 AAGCATTAGCAAGCCTGAAATGG + Intronic
1079791389 11:24744371-24744393 AACAAACAGCAAGATTGAAATGG - Intronic
1079951892 11:26816171-26816193 AAGAAGCAGCAAGATTGAAATGG - Intergenic
1081202765 11:40237879-40237901 AAGCAACAGCACAAATGAGAAGG + Intronic
1081826044 11:46052860-46052882 AAGCAAAGGCATCACAGAAAGGG + Intronic
1082209336 11:49479152-49479174 AAGGAACAGCAACCATGAAAAGG - Intergenic
1085895777 11:80637990-80638012 AAGCAGGAGCAACATTTAAAAGG - Intergenic
1086297864 11:85391268-85391290 AACAAGCAGCAAGACTGAAATGG + Intronic
1086640288 11:89146071-89146093 AAGGAACAGCAACCCTGAAAAGG + Intergenic
1086995038 11:93346641-93346663 AAGAAACAGTATCACTAAAATGG - Intronic
1087013625 11:93535802-93535824 CAGCAACAGCAGCACAGTAAAGG + Intronic
1088525707 11:110751490-110751512 AACAAGCAGCAAGACTGAAATGG - Intergenic
1088644063 11:111902164-111902186 CAGCCACAGAATCACTGAAAAGG - Intergenic
1088727952 11:112656202-112656224 CAGCAACAGAAAGACTGGAATGG - Intergenic
1088771058 11:113036505-113036527 GGGCAACGGCAACACAGAAAGGG - Intronic
1089032244 11:115344463-115344485 AAGCAACATCTGCACAGAAAAGG + Intronic
1089052451 11:115557522-115557544 AAGCGAGAGCAACGCAGAAAAGG + Intergenic
1089983257 11:122789833-122789855 AGGCAACTGCCAGACTGAAAAGG + Intronic
1090790087 11:130084670-130084692 CAGCAAAAGCACCACTGAGAGGG + Intronic
1090848571 11:130550554-130550576 AAGAAACAACAAGACTGATAAGG + Intergenic
1091030638 11:132184415-132184437 AAGAAACAGCAGCACTCACATGG - Intronic
1092303567 12:7276395-7276417 AACAAGCAGCAAGACTGAAATGG - Intergenic
1092730478 12:11528463-11528485 AAGCTAAAGCAATGCTGAAAAGG - Intergenic
1093164733 12:15791380-15791402 AAGAAACAGTAACACAGAACGGG + Intronic
1093642968 12:21549481-21549503 AATCATCAGAAACACTTAAATGG - Intronic
1093746200 12:22743507-22743529 ATGCAACAACAGCATTGAAATGG - Intergenic
1094610605 12:31991896-31991918 AAGCTAATGTAACACTGAAATGG + Intronic
1095681481 12:44981565-44981587 AAGCAGGAGCAACAGTGAGAGGG + Intergenic
1095728442 12:45477602-45477624 AAGAAAAAGCCACACTCAAAAGG + Intergenic
1095733038 12:45525941-45525963 AACAAACAGCAAGATTGAAATGG + Intergenic
1096944099 12:55384620-55384642 AAGTATCTGAAACACTGAAATGG + Intergenic
1097909410 12:64953325-64953347 AAGGCACAGCATGACTGAAATGG - Intergenic
1099340305 12:81423237-81423259 AAGAAGCAGTAACACTTAAAAGG + Intronic
1099524573 12:83704090-83704112 AAGCAAGAGCAAAGGTGAAAGGG - Intergenic
1099620927 12:85002249-85002271 ATGCAACAGAAACACTGAGATGG + Intergenic
1100138100 12:91580098-91580120 AAATAAGAGCCACACTGAAAAGG + Intergenic
1101497962 12:105273622-105273644 AGGCTAAAGCAACACTTAAAAGG + Intronic
1101570079 12:105945875-105945897 AAGCAACAACAACAACAAAAAGG + Intergenic
1101590059 12:106117458-106117480 AAGCAGCAGCAACACTGCCTTGG - Intronic
1101591513 12:106129308-106129330 AAGCACCAGCAATCCTGAGAAGG - Intronic
1101688863 12:107055706-107055728 AAGCAATATCAAAAATGAAAAGG + Intronic
1104264142 12:127215136-127215158 AGACAACAGCAACATTGAAGAGG + Intergenic
1104504207 12:129315802-129315824 AACAAGCAGCAAGACTGAAATGG - Intronic
1106323235 13:28661836-28661858 AAGGAAAAACAACACAGAAATGG - Intronic
1106349703 13:28917868-28917890 CAGCAAAAGCAATACTAAAAGGG - Intronic
1106434535 13:29712201-29712223 AGGCAGCAGCACCAATGAAATGG + Intergenic
1106648327 13:31661283-31661305 AAGAAACTGAAACACTGAAAGGG - Intergenic
1108478100 13:50841317-50841339 AAGGCCCAGCAGCACTGAAAGGG - Intronic
1108536186 13:51382080-51382102 AAGCAAAACCAACATTGAAGTGG - Exonic
1108697645 13:52916817-52916839 CAGAAACAGAAACACTAAAATGG - Intergenic
1109223657 13:59666661-59666683 AAGCAACAGAAAAAAGGAAACGG - Exonic
1109440757 13:62369528-62369550 AAGCACCAGCAAAACAGTAAGGG - Intergenic
1109869908 13:68321182-68321204 AAGCAGCAGCATCCCTGCAATGG - Intergenic
1110316967 13:74119776-74119798 GAGCAATAGAAACACTGAAAAGG + Intronic
1110373496 13:74765956-74765978 AAGGAACAGCGACACTGGAGTGG + Intergenic
1110548566 13:76784895-76784917 CAGCAGCAGCAATGCTGAAAGGG + Intergenic
1110783561 13:79495824-79495846 AGGCAACAGAAATATTGAAAGGG - Intronic
1111853357 13:93605058-93605080 AAACAACAGCAACAAAAAAAAGG - Intronic
1111988707 13:95093021-95093043 AACAAGCAGCAAGACTGAAATGG + Intronic
1112475763 13:99729873-99729895 AGGCACCAGCCACACTGAAGCGG - Intronic
1112567133 13:100561387-100561409 AAACAAAAATAACACTGAAATGG + Intronic
1112740004 13:102462280-102462302 AAGTAACAGCAACAGTAGAAGGG - Intergenic
1112893987 13:104274831-104274853 AAGAAACAGTAACAGTAAAAGGG - Intergenic
1112951496 13:105002852-105002874 ATGCAACACCAAAAATGAAAAGG - Intergenic
1113282630 13:108806199-108806221 AAGGCACAGAAACACTGAAAAGG - Intronic
1113419724 13:110161468-110161490 AATCAACATAATCACTGAAATGG + Intronic
1113491847 13:110698554-110698576 AAGCACCAGAAACACTGCTATGG + Intronic
1114692479 14:24596888-24596910 AAGCAAAAGCAATATTAAAAGGG - Intergenic
1115188556 14:30721083-30721105 AAGGAACTGGAACACTGAAGAGG + Intronic
1115338403 14:32266048-32266070 CAGCAAAAGCAATACTGAGAAGG + Intergenic
1115523757 14:34258908-34258930 AGGCAACAGAAACCCTGAAATGG + Intronic
1117428354 14:55624679-55624701 AGGAAACACCAACAATGAAAGGG + Intronic
1118352724 14:64985068-64985090 CAGCAACAGTACCACTAAAATGG + Intronic
1118520734 14:66582276-66582298 AACCAAGAGTAAAACTGAAATGG + Intronic
1118997522 14:70850198-70850220 AAGCAACTGCAATATTGAGAAGG - Intergenic
1119360088 14:74042049-74042071 CAACAACAACAAAACTGAAATGG + Intronic
1120777105 14:88450012-88450034 AAGAAACAGAAACTCTGAACAGG - Intronic
1121589821 14:95095478-95095500 AACCAAAAGCAGCACTGAATGGG + Intronic
1122055797 14:99097480-99097502 AGGTAAGAGCAACACTCAAAGGG - Intergenic
1124444664 15:29719684-29719706 AAGCAAAAGGAACACTTAAAGGG + Intronic
1124561136 15:30774424-30774446 AGGTATCCGCAACACTGAAATGG + Intergenic
1124655099 15:31501048-31501070 CAACATCAGCAGCACTGAAATGG + Intronic
1124669394 15:31624635-31624657 AGGTATCCGCAACACTGAAATGG - Intronic
1125384128 15:39118580-39118602 AAGAAACTGAAACACTGAACAGG + Intergenic
1125474370 15:40036330-40036352 CAGCAACAGCAGCACAGTAAAGG - Exonic
1125827425 15:42688261-42688283 AAGCATCAGCAAGTCTCAAAGGG + Exonic
1126060277 15:44774189-44774211 AACAAGCAGCAAGACTGAAATGG - Intergenic
1126144751 15:45464100-45464122 AAGCAAAAGAATCACAGAAAAGG - Intergenic
1126242581 15:46462100-46462122 AAGCAGAAGCAGCACTAAAAAGG - Intergenic
1126550774 15:49926818-49926840 ATGCAACAGCAGCACTGTGAAGG + Intronic
1126692693 15:51300024-51300046 GAGCAACAGGAAGAGTGAAACGG + Intronic
1126741058 15:51776423-51776445 AAGCAACATCAGCAAAGAAAAGG - Intronic
1126891292 15:53207174-53207196 AACCAACAGCTAGACTGGAAGGG + Intergenic
1127014763 15:54671802-54671824 AACCAGCAGCAAGATTGAAATGG + Intergenic
1127226708 15:56938679-56938701 AACAAGCAGCGACACTGAAATGG - Intronic
1127524832 15:59782732-59782754 AAGAAACTGCAACAATTAAAGGG - Intergenic
1129039983 15:72677408-72677430 CAACAACAGCAAGACTGCAAGGG + Intronic
1130405920 15:83601859-83601881 AACAAGCAGCAAGACTGAAATGG - Intronic
1131510717 15:93048161-93048183 AAGCCACAGCAACACGGCCAGGG - Intronic
1132000317 15:98172907-98172929 AAGCAACAGAAAGAGGGAAAAGG - Intergenic
1135634754 16:24065086-24065108 AGGCTACAGAAAGACTGAAAGGG - Intronic
1139072357 16:63398587-63398609 AAGGAACAGCAATGCTGCAAGGG - Intergenic
1139302394 16:65956517-65956539 AAGCCACAGAAAAACTGAAAGGG + Intergenic
1144318726 17:14091375-14091397 AAGGAACAGCAACACCAATAAGG + Intronic
1145881468 17:28355898-28355920 AAGCAACAGAAAAGCTGAGAAGG + Intronic
1146393824 17:32445472-32445494 ACACAACAGGAAAACTGAAATGG + Intronic
1146640724 17:34539073-34539095 AAGCATCAGTAACAATGAGAAGG - Intergenic
1147060167 17:37869585-37869607 AAGTAGCAGCAACCCTGAACTGG + Intergenic
1148145532 17:45362221-45362243 CAGTGACAGCAACACTGGAAAGG + Intergenic
1148409439 17:47452075-47452097 AAGTAGCAGCAACCCTGAACTGG + Intergenic
1149121524 17:53172490-53172512 AAGCAAAAGCCAAAGTGAAATGG - Intergenic
1149935030 17:60796389-60796411 AACAAGCAGCAAGACTGAAATGG - Intronic
1149974459 17:61251737-61251759 AAGCAATAGCAACTGGGAAAAGG + Intronic
1153022604 18:644551-644573 AAGCGTGAGCAAAACTGAAAAGG + Intronic
1155237536 18:23835784-23835806 AAGATGCTGCAACACTGAAAGGG - Intronic
1155280444 18:24234101-24234123 AAGAAAAAACAACACTGATAGGG + Intronic
1156051005 18:32934106-32934128 GATCCACAGCAAAACTGAAATGG - Intergenic
1156656147 18:39289468-39289490 TAGCTACAACAGCACTGAAATGG + Intergenic
1156976421 18:43226945-43226967 AAGTAATAGGAACACTGTAATGG + Intergenic
1157725782 18:49962660-49962682 AAGCAACAGCAAGCCAGATATGG - Intronic
1157867319 18:51197594-51197616 AAACAAAAGAAACACTGAGAGGG - Intronic
1157987202 18:52451587-52451609 AAACACCAGCACCACTGAAGTGG - Intronic
1158070748 18:53467791-53467813 AAGCATCTGTAAGACTGAAAAGG + Intronic
1159216953 18:65404755-65404777 AAGCAATTGCAACACAAAAATGG + Intergenic
1159335241 18:67055473-67055495 AAGGAAGAGAAACACTGACATGG - Intergenic
1159821949 18:73156209-73156231 GAACAACAGTAAGACTGAAAAGG - Intronic
1161106945 19:2448471-2448493 AAAAAACAGCAACTCTGCAATGG + Intronic
1162504132 19:11072700-11072722 AAACACCAGCATCACTGAAATGG + Intergenic
1163932718 19:20412702-20412724 AAGCAACATCAGCATTGACAGGG - Intergenic
1163936424 19:20448757-20448779 AAGCAACATCAGCACTGACAGGG + Intergenic
1163956762 19:20649799-20649821 GAGCAACATCAGCATTGAAAGGG - Intronic
1163984373 19:20931187-20931209 AAGCAACATCAGCACTGACAGGG + Intronic
1164102595 19:22070758-22070780 GAGCAACATCAACATTGACAGGG + Intronic
1164224877 19:23234864-23234886 AAGCAACATCAGCATTGACAGGG - Intronic
1164880476 19:31728539-31728561 CAGCTACAGAAACAATGAAAAGG + Intergenic
1165165664 19:33853611-33853633 AAGCAACAGAAAACCTGAACAGG + Intergenic
924997490 2:375792-375814 AAGTAACAGCATCACAGGAAAGG - Intergenic
926598592 2:14817140-14817162 ATGAGACAGCAACACTGACATGG - Intergenic
926921966 2:17947856-17947878 TAGCACCAGCAACACGCAAATGG + Intronic
927328063 2:21829455-21829477 AACAAGCAGCAAGACTGAAATGG - Intergenic
927993230 2:27462937-27462959 TAGCAAAAGCAATTCTGAAATGG + Intronic
928174969 2:29027245-29027267 AAACAAGAGCAACACTCAATGGG - Intronic
928388403 2:30889089-30889111 AATCATCTGCAACTCTGAAAAGG - Intergenic
928486006 2:31732515-31732537 CAGCAAAAGCAATACTAAAAGGG + Intergenic
928843443 2:35638697-35638719 AAACAACAACAACACTGACTGGG - Intergenic
928960156 2:36916315-36916337 TAACAACAGCAACAACGAAAAGG - Intronic
930148236 2:48030044-48030066 AAACAACAGAAAAACTCAAAAGG - Intergenic
930189667 2:48444412-48444434 AAGAAACAGCAAGTCAGAAATGG - Intronic
930223552 2:48769125-48769147 AAGCAAGAGAAACACTAAAATGG + Intronic
930403381 2:50921453-50921475 AAGCATGTGCACCACTGAAATGG - Intronic
931604953 2:64042889-64042911 AAGCAACAGCAACATTTGAATGG - Intergenic
932384595 2:71320083-71320105 AACAAGCAGCAAGACTGAAATGG - Intronic
933139280 2:78773959-78773981 AAGCAACACCAATACTAGAAGGG + Intergenic
933148205 2:78882815-78882837 CAGAAACAGCAAAACAGAAAAGG - Intergenic
934088511 2:88530211-88530233 AATCAACAGCAACAGTTTAAAGG + Intergenic
934145044 2:89084966-89084988 ATGTAATAGCCACACTGAAATGG + Intergenic
934224210 2:90115589-90115611 ATGTAATAGCCACACTGAAATGG - Intergenic
934893129 2:98087778-98087800 AAGCCAAAGCAACACTTACATGG + Intronic
935127109 2:100234250-100234272 AATCAACAGCAACAGTAAGAGGG + Intergenic
935393244 2:102576930-102576952 AAGCAACAGCATTACTAAGAAGG - Intergenic
935458960 2:103306076-103306098 AAAAAAAAGAAACACTGAAATGG - Intergenic
937740831 2:125351149-125351171 AAGCATCAGGAAGACTAAAACGG - Intergenic
938677152 2:133648739-133648761 CAGCAAAAGCAATACTAAAAGGG + Intergenic
938943259 2:136187889-136187911 AAGGAACAGCAACCCTGAGAAGG - Intergenic
940785671 2:157979046-157979068 CAGCAAAAGCAGCACTAAAAAGG - Intronic
941205203 2:162563442-162563464 AAGCAAAACCACCACTGAGAAGG - Intronic
942356807 2:175123805-175123827 CAGGGACAGCAACACTGCAAAGG + Intronic
942520060 2:176794383-176794405 AAGGAACAACAACATTCAAAGGG + Intergenic
942826465 2:180182970-180182992 AAGAAACTAAAACACTGAAAAGG + Intergenic
943107395 2:183562530-183562552 AAAAAACAGCAACATTCAAAGGG + Intergenic
944519364 2:200548456-200548478 TGGCAAAAGCAATACTGAAAGGG + Intronic
944603292 2:201325620-201325642 AAGAAACAGAAACCCTGAACAGG + Intronic
945362659 2:208910328-208910350 AACAAACAGCAAGAATGAAATGG + Intergenic
945826036 2:214721090-214721112 AACAAGCAGCAAGACTGAAATGG + Intergenic
945828591 2:214755648-214755670 AAGCAACATGATTACTGAAATGG + Intronic
946802042 2:223428289-223428311 AAAAAGCAGCAAGACTGAAATGG - Intergenic
946967651 2:225054788-225054810 AAGCAACAACAACAACAAAATGG - Intergenic
947024907 2:225726428-225726450 AAGTAACAACACCACTGAAAGGG + Intergenic
947324619 2:228960963-228960985 TAGCAAAAGCAACAGTGATATGG - Intronic
947456774 2:230262112-230262134 AACAAGCAGCAAGACTGAAATGG - Intronic
948798943 2:240421469-240421491 AAGCACAAGCAACACTGATGCGG + Intergenic
1169210196 20:3761773-3761795 AAGTCACAGCATCACTGACAAGG + Intronic
1169291168 20:4354266-4354288 TAGCAACAGTATCAGTGAAATGG - Intergenic
1169725715 20:8727279-8727301 AAGCAACAACAAAACAAAAAAGG - Intronic
1170352776 20:15460247-15460269 AAATAATAGAAACACTGAAAAGG - Intronic
1170781020 20:19425368-19425390 AAGCAACAGTAACAACAAAAAGG - Intronic
1171147127 20:22794761-22794783 AACCAACAGAACAACTGAAAAGG + Intergenic
1172790051 20:37497084-37497106 AAGCAAAAGCAAAACAAAAAAGG + Intronic
1173062476 20:39675590-39675612 AAGTGACAGCAATTCTGAAAAGG - Intergenic
1173342427 20:42164375-42164397 CAGCAAAACCAACACTGGAATGG + Intronic
1173658421 20:44716698-44716720 AAGCCACAGCAACCCTCAGAGGG + Intronic
1173727382 20:45307204-45307226 AAGAAACAGCAACAGAAAAATGG - Intronic
1174502286 20:50994283-50994305 ACTCAACAGCAACAATGAAAAGG - Intergenic
1177524565 21:22274919-22274941 TAGCTACAGCATCAGTGAAATGG + Intergenic
1178193164 21:30310035-30310057 AAGGAACAGAAAAAGTGAAAAGG + Intergenic
1178223353 21:30686096-30686118 AAGAGACAGTAACAGTGAAAAGG - Intergenic
1178401378 21:32287974-32287996 AAGTAACAGAAACACAGAAGAGG + Intergenic
1179161507 21:38903326-38903348 AAGCATCAGGAACACTGAAAGGG + Intergenic
1179199824 21:39206135-39206157 AAGCAACGGCAAAATTGTAAAGG - Exonic
1181642525 22:24210877-24210899 AAGCAAAAACAAAACTGAAGGGG + Intergenic
1181995343 22:26876238-26876260 AAGCAAGAGAAAAACTAAAAAGG - Intergenic
1183560301 22:38567788-38567810 AAGAAGCACCAACATTGAAAGGG + Intronic
949108540 3:229945-229967 AAGCAACAGCTGCACAGACAAGG - Intronic
949642159 3:6048944-6048966 AAGCAAAAGCAATTCTAAAAAGG + Intergenic
951197963 3:19845439-19845461 AAGAAACAGCATCAATGAATGGG - Intergenic
952653117 3:35750216-35750238 CAGCTAAAGCAAGACTGAAAGGG - Intronic
955340149 3:58118922-58118944 CAGCAACACCCACAGTGAAAGGG - Exonic
955840363 3:63106400-63106422 AAGCATCAGAAACACTGCATGGG + Intergenic
956966319 3:74465311-74465333 AAGCAACAACAACAACAAAAAGG + Intronic
957869231 3:86066445-86066467 AGGCAAGAGCCAAACTGAAATGG - Intronic
957921473 3:86753985-86754007 AAGAAACAGAAACCCTGAACAGG - Intergenic
958163693 3:89851677-89851699 AAGCAACATAAACATAGAAATGG + Intergenic
958906702 3:99949676-99949698 AAGGTACAACAACACTTAAAAGG + Intronic
959328217 3:104966118-104966140 AAGGAACAGAAACACAGAATGGG - Intergenic
959751057 3:109835644-109835666 AAGCAAAGGCAACAGTAAAATGG + Intergenic
961253941 3:125530646-125530668 AAGCAACACCTTCACTGAAATGG + Intronic
961354029 3:126322726-126322748 AGGCAAGAGCTACACTGAAATGG - Intergenic
962335052 3:134521799-134521821 AAACTTCAGTAACACTGAAAGGG - Intronic
962431030 3:135320027-135320049 AATGAGCAGCAACAATGAAATGG - Intergenic
962655661 3:137542088-137542110 CAGCAACGGCAACACAGAACAGG + Intergenic
963303840 3:143627733-143627755 AAATGACAGCAACAATGAAAAGG - Intronic
963469535 3:145722610-145722632 AAACAACAGAAAGAGTGAAATGG + Intergenic
963853314 3:150228488-150228510 AAGGAAAAGCAAAACTGGAAGGG - Intergenic
963905018 3:150766169-150766191 AAGCAGCAGCGACACTCCAAAGG - Intergenic
965147671 3:164927601-164927623 AAGCACCTGTTACACTGAAAGGG + Intergenic
965700119 3:171452097-171452119 ATCCAGCAGCAACACTGTAAGGG + Intronic
966276830 3:178182941-178182963 AAACAGCAGCAACACTGCAAAGG + Intergenic
966376622 3:179302688-179302710 AAGCTCCAGGACCACTGAAACGG + Intergenic
967236384 3:187388205-187388227 AACAAACAGCAACATTGAAAGGG + Intergenic
967834933 3:193953811-193953833 AAGCAAAAGCAATACTAAGAAGG - Intergenic
968894713 4:3392497-3392519 GAGCAAGAGAAACAATGAAATGG - Intronic
969549330 4:7853936-7853958 AAGGAACAGCCCCACTGAAGGGG + Intronic
969970809 4:11046315-11046337 AAGAAACTGCATCAATGAAAGGG - Intergenic
970530534 4:16977501-16977523 CAGCTGAAGCAACACTGAAAGGG + Intergenic
970605487 4:17677509-17677531 AACAAGCAGCAAGACTGAAATGG + Intronic
970672682 4:18414656-18414678 AAGAAACCACAACAATGAAAGGG + Intergenic
970745808 4:19293951-19293973 AATCATCAGCATCTCTGAAAAGG - Intergenic
970818209 4:20182990-20183012 AGGAAAAAGAAACACTGAAAAGG - Intergenic
970925802 4:21450602-21450624 AAGCAACAGCAGCATTTTAAAGG + Intronic
972806739 4:42536430-42536452 GATCAGCAGCAAGACTGAAATGG + Intronic
973317394 4:48776486-48776508 AGGCAACAGTAAAAATGAAAGGG + Intronic
974135406 4:57810494-57810516 TAGCAAAAGCAACACCTAAAGGG - Intergenic
976183956 4:82427243-82427265 CAGCAACAGCAACAACAAAAAGG - Exonic
976556480 4:86456636-86456658 AACAAACAGCAATATTGAAATGG + Intronic
977411165 4:96666173-96666195 GAACAACAACAACAATGAAACGG + Intergenic
977572908 4:98648320-98648342 AAGGAACAGCAACAGTGGATGGG + Intronic
982334117 4:154214746-154214768 AATCAAAAGCAACACAGGAAGGG + Intergenic
982666469 4:158270152-158270174 CAGCCACAGCCACACTTAAAGGG + Intergenic
983283235 4:165707343-165707365 AAGCAAAATAAACACTGAATTGG + Intergenic
984315669 4:178128403-178128425 AAGCCACAACTCCACTGAAATGG + Intergenic
984611312 4:181842539-181842561 TAGCAAAAGCAACAGCGAAAAGG - Intergenic
985240480 4:187926105-187926127 AAGCAGCAGCAAGATTGAAATGG - Intergenic
985375795 4:189337190-189337212 GAGCAAAAGCAATTCTGAAAGGG - Intergenic
986057389 5:4152211-4152233 AAGCAATAGCAACCCTGGACAGG + Intergenic
987227987 5:15863551-15863573 CAGCAAGAGGAACACAGAAATGG - Intronic
988189042 5:27903197-27903219 AGGCAACAGGAACACAGAATGGG + Intergenic
989287563 5:39720417-39720439 AAGCAAAACCAACACTGAAGTGG - Intergenic
989671060 5:43917602-43917624 CAGCACCAACATCACTGAAAAGG - Intergenic
989687742 5:44109301-44109323 AAACAACAGCAACAAGAAAATGG + Intergenic
992849170 5:80787536-80787558 AAGCAGCAGCAACAACAAAAAGG - Intronic
993045142 5:82858067-82858089 AAATAACAGCAACACAAAAAGGG + Intergenic
993250055 5:85510266-85510288 AACAAACAGCAAGATTGAAATGG - Intergenic
993955121 5:94223151-94223173 AAGCAACAGCAACAACAAAAAGG - Intronic
994696243 5:103076054-103076076 AAGCAAGAGAAAGACAGAAACGG - Intergenic
994875596 5:105416892-105416914 AACAAGCAGCAAGACTGAAATGG + Intergenic
995293478 5:110488015-110488037 AACAAGCAGCAAGACTGAAATGG - Intronic
995375155 5:111465684-111465706 AAGAAGCAGCAAGATTGAAATGG + Intronic
995986586 5:118183212-118183234 CAGTAACTGCAACACAGAAACGG + Intergenic
996325695 5:122270534-122270556 AACAAACAGCAAGATTGAAATGG + Intergenic
996409942 5:123147381-123147403 ACACAACATCAACACTAAAAAGG - Intronic
997072841 5:130639114-130639136 AGGCAACTGAAACACTGAAGAGG + Intergenic
997942990 5:138175203-138175225 AAGCAATAGCAACAAAGAAATGG - Intronic
998341794 5:141424036-141424058 AAGGCACAGCAAAATTGAAATGG - Intronic
998912934 5:146980500-146980522 AAGAAACAGCAACAAGGAAAAGG + Intronic
999677419 5:154018389-154018411 AACAAGCAGCAAGACTGAAATGG + Intronic
1000573665 5:162948389-162948411 AAGCAGCAGCAAGACGAAAATGG + Intergenic
1001870707 5:175152430-175152452 AAGCAAAGGCAACATTGAAAAGG + Intergenic
1003297195 6:4841073-4841095 AACAAACAGTGACACTGAAATGG - Intronic
1003538212 6:6994747-6994769 AATCAACAGTAACACTGAGTGGG - Intergenic
1004917930 6:20349226-20349248 GATAAACAGCACCACTGAAAGGG + Intergenic
1005107619 6:22241930-22241952 AACAAGCAGCAAGACTGAAATGG + Intergenic
1005691260 6:28308396-28308418 AACAAGCAGCAAGACTGAAACGG - Intergenic
1005784217 6:29226404-29226426 AGGCAACAGCCACACTGGAATGG - Intergenic
1008827742 6:55718655-55718677 AAGAAACGACAACAGTGAAAGGG + Intergenic
1010023528 6:71189226-71189248 AAACAGCAGCAAAACTGAATTGG + Intergenic
1011168920 6:84482495-84482517 AATGAGCAGCAAGACTGAAATGG + Intergenic
1011504500 6:88027471-88027493 AAGCAGAAGCAACACGGACAGGG + Intergenic
1011723668 6:90185921-90185943 AAGCATCAGTAACACTAAACTGG - Intronic
1011815145 6:91180728-91180750 AAGCTACAGGAACTCTGATAGGG + Intergenic
1012050193 6:94331798-94331820 AAGCAAAAGCAGTACTAAAATGG + Intergenic
1012306300 6:97662213-97662235 AAGGAATAGCACAACTGAAATGG - Intergenic
1012376408 6:98567074-98567096 AAGTAGCAGCAACACCCAAAAGG + Intergenic
1013492758 6:110665423-110665445 AAGCAGCAGCAAATCTGAATGGG + Intronic
1014440909 6:121472902-121472924 ACACAAGAGCAAGACTGAAATGG - Intergenic
1016491994 6:144615733-144615755 AAGCAAAAACAACACTTAGATGG - Intronic
1016642812 6:146369469-146369491 TAGCAAAAGCAGCACTGAAAGGG - Intronic
1016805681 6:148210059-148210081 ATGAAACATCAGCACTGAAAAGG + Intergenic
1016871059 6:148817132-148817154 AACAAACAGAAACACTGGAAAGG - Intronic
1017414026 6:154200859-154200881 AAGCAACATCACCAATGATATGG + Intronic
1018122452 6:160649100-160649122 AAACAATAGCAAAACTGAAAAGG - Intronic
1019364427 7:625253-625275 TAGCAAAAGCAACACTTAGAGGG + Intronic
1020955205 7:14732206-14732228 AAGAAAAAACAAAACTGAAAAGG - Intronic
1021124592 7:16836648-16836670 AATCAACCGCAACACTCACACGG - Intergenic
1021272996 7:18615364-18615386 AAACAACAGCAACAAAAAAAGGG + Intronic
1023649603 7:42355191-42355213 AAGCAAAAGCAAAACTCAAAAGG - Intergenic
1025071555 7:55904042-55904064 AAGAAGCAGCAACACATAAAAGG + Intronic
1026349713 7:69505018-69505040 AAAGAACAGCTAGACTGAAAAGG + Intergenic
1027602552 7:80257141-80257163 GAGAAAGAGCCACACTGAAATGG - Intergenic
1028097696 7:86782679-86782701 AAGAACCAGCAACACAGAATGGG - Intronic
1028444496 7:90904863-90904885 TTTCAACAGTAACACTGAAAGGG + Intronic
1028543234 7:91968734-91968756 AAGCAAAAGCAGTACTGAGAGGG - Intronic
1028993134 7:97071825-97071847 AACAAGCAGCAACATTGAAATGG - Intergenic
1029840386 7:103356805-103356827 AAGCAACATTAACACCCAAAAGG - Intronic
1030141447 7:106308210-106308232 AGGCAGCAGCAACGATGAAAAGG - Intergenic
1030546367 7:110900979-110901001 AAGCAACAGCCACATTTAGAAGG - Intronic
1030986858 7:116251751-116251773 CAGCAATAGCAGGACTGAAAGGG - Exonic
1031746232 7:125501795-125501817 AAATAACATCAACATTGAAATGG - Intergenic
1032003940 7:128285155-128285177 AAGAAACAGCCACATTGGAAAGG - Intergenic
1032911929 7:136442536-136442558 AACAAGCAGCAAGACTGAAATGG + Intergenic
1034307187 7:150053633-150053655 AAGCAACAGCGAAACCAAAATGG + Intergenic
1034705226 7:153136511-153136533 AACAAATAGCAAGACTGAAATGG - Intergenic
1034799660 7:154047050-154047072 AAGCAACAGCAAAACCAAAATGG - Intronic
1035340785 7:158159596-158159618 AAACACCAGCCACACTGAACGGG - Intronic
1037027117 8:14052586-14052608 AAATAACAGCAAAACAGAAAGGG - Intergenic
1037119885 8:15270514-15270536 GAGCAAAAGCAACCTTGAAAAGG + Intergenic
1037276269 8:17183152-17183174 AAGCACCAGCACCTCTGGAATGG + Intronic
1038245229 8:25848886-25848908 AGGAAACATCAACACTGAAGAGG + Intronic
1040762693 8:50869866-50869888 AAGCAACAGCAGCAGAGAATAGG - Intergenic
1041081514 8:54219220-54219242 AGGCAAAAGCAACATTGACAAGG - Intergenic
1041414565 8:57593628-57593650 AAGCTATAGCAACAGTAAAAAGG - Intergenic
1041426999 8:57733002-57733024 AAGCAAGAACAACTCTGCAATGG + Intergenic
1041566886 8:59288741-59288763 AGGAAACAGAAACACTGAGATGG + Intergenic
1041576802 8:59406375-59406397 GAGCAAGAGCAACAATAAAATGG - Intergenic
1041761900 8:61376344-61376366 AAGCCACAGGAACACAGAAGAGG + Intronic
1042704216 8:71649699-71649721 AAGCAGCAGCAACAGTAGAATGG - Intergenic
1043304486 8:78777486-78777508 AAGGAAGAGTAAAACTGAAATGG - Intronic
1044074142 8:87797378-87797400 AGGCAACAGAAACAAAGAAAGGG + Intergenic
1045689946 8:104749961-104749983 GAACAACAGCAACAACGAAAAGG - Intronic
1045897874 8:107240186-107240208 AAGCTACAAGAACACTGAGATGG - Intergenic
1046118635 8:109816858-109816880 GAGCAATAGTAACAATGAAAGGG + Intergenic
1046208202 8:111031956-111031978 AAGTGACAGAAACTCTGAAAAGG + Intergenic
1046240203 8:111479550-111479572 AAACAAGAGAAACACTGCAAAGG - Intergenic
1046426303 8:114055078-114055100 AAGCAACAGAAACAATAAAAAGG + Intergenic
1046642842 8:116751758-116751780 AAGCAGCAGCAAAGCTTAAATGG + Intronic
1046847219 8:118931160-118931182 CAGCAACAGCAACAACAAAACGG + Intronic
1047456189 8:125014556-125014578 CAGCAAAAGCAATACTTAAAGGG - Intronic
1050105750 9:2164672-2164694 AATAAACAGTACCACTGAAACGG - Intronic
1050250851 9:3742856-3742878 AAGCAACAGCAAATCTTACATGG - Intergenic
1051307685 9:15732144-15732166 CATCAAAAGAAACACTGAAAAGG - Intronic
1051656823 9:19390208-19390230 CAGCTAAAGCAGCACTGAAAGGG + Intergenic
1053248849 9:36557825-36557847 AAATAACAGCACCACTGTAAGGG - Intergenic
1054818196 9:69495971-69495993 CAGCGACACCAACACAGAAAAGG + Intronic
1054822263 9:69534724-69534746 GAGAAACAGAAACAGTGAAAAGG - Intronic
1056806293 9:89731645-89731667 AAGCCTCAGCAACACAGAATAGG - Intergenic
1057496708 9:95566809-95566831 AAGCAACAGAAAAACAGAAAGGG - Intergenic
1057600593 9:96453612-96453634 TAGGAAAAGCAAAACTGAAACGG - Intronic
1058184198 9:101835226-101835248 TAGCAACAGTAATACTAAAATGG - Intergenic
1058609081 9:106755563-106755585 AAGCAACAGCTTCCCTCAAATGG - Intergenic
1059706889 9:116833296-116833318 AAACACAAGCAAGACTGAAAAGG - Intronic
1059884856 9:118734467-118734489 AAACAACAGGAGCACTGAAATGG - Intergenic
1060694137 9:125691628-125691650 AAGGAACAGCAATAGTTAAAGGG + Intronic
1061748074 9:132754596-132754618 AAGCACCAGCATCACAGAGAGGG - Intronic
1203699163 Un_GL000214v1:121482-121504 AAGCAACAGCAAAACGCTAAAGG - Intergenic
1203700114 Un_GL000214v1:127792-127814 AAGCAACAGCAAAACGCTAAAGG - Intergenic
1203701028 Un_GL000214v1:133776-133798 AAGCAACAGCAAAACGCTAAAGG - Intergenic
1185951148 X:4435753-4435775 AAGCATCAGCAACACACACAAGG + Intergenic
1186113519 X:6280272-6280294 AAGAAACAGCATCACGGAAATGG - Intergenic
1186332461 X:8549556-8549578 AAGCAACACCAAGCCTTAAAAGG + Intronic
1186693319 X:12003118-12003140 AAGCAGCAGCAACATTGAGCTGG + Intergenic
1187374726 X:18741749-18741771 AAGCAGCAGCCAGACTCAAATGG - Intronic
1187695874 X:21919415-21919437 AACAAGCAGCAAGACTGAAATGG - Intergenic
1187748990 X:22440899-22440921 AACAAACAGCAAGATTGAAATGG + Intergenic
1188375171 X:29419734-29419756 GAGCAACAGCTGCACTGAAGTGG - Intronic
1189293624 X:39903449-39903471 AAACAAAAGCAAAAATGAAAGGG + Intergenic
1189753378 X:44245931-44245953 AAGCAGCAGCAACACAGCTAGGG - Intronic
1192095564 X:68207107-68207129 AAACAAAAACAACACTGATAGGG - Intronic
1192880816 X:75281927-75281949 AACAACCAGCAAGACTGAAATGG - Intronic
1192978123 X:76307655-76307677 AACCAAAAGCAGCACTGAAGAGG - Intergenic
1193714529 X:84922363-84922385 AAGAATCAACAGCACTGAAATGG - Intergenic
1193775712 X:85638895-85638917 AACCAGCAGCAAGACTGAAATGG - Intergenic
1193789706 X:85802502-85802524 AATCAACAGCTTCCCTGAAATGG - Intergenic
1194165954 X:90516342-90516364 TAGCAAAAGCAATACTGAGAAGG + Intergenic
1194875287 X:99179493-99179515 TAGGCACAACAACACTGAAATGG - Intergenic
1194878359 X:99218878-99218900 AAGCAACAGGAAAAAAGAAAGGG + Intergenic
1196314243 X:114204083-114204105 AAGCTACAGAAAGACTGAAAGGG + Intergenic
1198122641 X:133609052-133609074 AAGCAACAGCAGCAAAGGAATGG + Intronic
1198209567 X:134504547-134504569 AAATAACGGCCACACTGAAAGGG - Intronic
1198879543 X:141264283-141264305 AAGCACCAGCAAACCTGCAAGGG + Intergenic
1200512225 Y:4094113-4094135 TAGCAAAAGCAATACTGAGAAGG + Intergenic
1200714436 Y:6520934-6520956 AGGCAGAAGAAACACTGAAAAGG - Intergenic
1200831013 Y:7689045-7689067 AGGCAGAAGAAACACTGAAAAGG + Intergenic
1201019387 Y:9640222-9640244 AGGCAGAAGAAACACTGAAAAGG + Intergenic
1201226744 Y:11825847-11825869 ATGCTACAGCAACACAGATACGG + Intergenic
1202115918 Y:21468636-21468658 AGGCAGAAGAAACACTGAAAAGG - Intergenic