ID: 916437074

View in Genome Browser
Species Human (GRCh38)
Location 1:164787344-164787366
Sequence GGGCAGATCTACAGGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 273}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916437074_916437085 8 Left 916437074 1:164787344-164787366 CCACCCTCCCTGTAGATCTGCCC 0: 1
1: 1
2: 0
3: 20
4: 273
Right 916437085 1:164787375-164787397 TCCCAACCTGCCCCCACCTGTGG 0: 1
1: 0
2: 3
3: 57
4: 372
916437074_916437094 29 Left 916437074 1:164787344-164787366 CCACCCTCCCTGTAGATCTGCCC 0: 1
1: 1
2: 0
3: 20
4: 273
Right 916437094 1:164787396-164787418 GGAAGTTTGAATCTGAGCAGAGG 0: 1
1: 0
2: 1
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916437074 Original CRISPR GGGCAGATCTACAGGGAGGG TGG (reversed) Intronic
900078211 1:835059-835081 GGGCAGATGGATGGGGAGGGAGG - Intergenic
900187552 1:1339470-1339492 GGACAGATGGACAGGGTGGGAGG + Intronic
900304553 1:1998425-1998447 GTCCAGATCTACACGTAGGGAGG + Intronic
902294501 1:15457210-15457232 GGGGAGATGTAAAGGGAGTGGGG - Intronic
902377021 1:16034742-16034764 GGGCAGATACACAGAGAGAGTGG + Intergenic
902532373 1:17098769-17098791 GGGCATGACTACAGGGTGGGCGG - Intronic
902711928 1:18246319-18246341 GGGCAAATCTATAGGCAGGAAGG - Intronic
903229107 1:21911253-21911275 GGGAAGATGTACTGGGAGGAGGG + Intronic
904293912 1:29505577-29505599 GGGAACATCTTCAGGGAGAGAGG + Intergenic
904447482 1:30586946-30586968 GTGCAGGTGAACAGGGAGGGAGG - Intergenic
904493411 1:30873901-30873923 GGGCAGGTCCACAGGGACTGGGG + Intronic
904598029 1:31658868-31658890 GGGCAAAACTCCTGGGAGGGAGG + Intronic
904860312 1:33533010-33533032 GGGAAGCTCTCCAGGGCGGGAGG - Intronic
905646415 1:39627564-39627586 GGGCAGATGCCCAGGAAGGGAGG + Intronic
913565574 1:120069448-120069470 GGGCAGATCCACATGGGGAGGGG + Exonic
913632556 1:120724105-120724127 GGGCAGATCCACATGGGGAGGGG - Intergenic
914286171 1:146228823-146228845 GGGCAGATCCACATGGGGAGGGG + Exonic
914547199 1:148679567-148679589 GGGCAGATCCACATGGGGAGGGG + Intronic
914619304 1:149390779-149390801 GGGCAGATCCACATGGGGAGGGG - Intergenic
915713992 1:157926734-157926756 ATGCAGAGCTCCAGGGAGGGAGG + Intergenic
916437074 1:164787344-164787366 GGGCAGATCTACAGGGAGGGTGG - Intronic
917655168 1:177118877-177118899 GGGCAGACTTACTGGGTGGGAGG + Intronic
919785994 1:201259166-201259188 GGGCAGAGCTGGAGGGAGGCAGG + Intergenic
920322592 1:205135999-205136021 GGTCCCAGCTACAGGGAGGGAGG - Intergenic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
923471494 1:234294882-234294904 GGGCAGATTTACAGGGTGCCTGG + Intronic
1063095751 10:2907472-2907494 GGGCAGATCTGCAGAGGGGAGGG - Intergenic
1063968495 10:11364950-11364972 GGGGACATCTCCAGGCAGGGGGG - Intergenic
1064210886 10:13359756-13359778 AGCCAGGTCTACAGGGAGTGGGG - Intergenic
1064557959 10:16566507-16566529 AGGCAGAGCGAGAGGGAGGGAGG + Intergenic
1069238719 10:66111239-66111261 AGGCACATCTACAGGGCAGGAGG - Intronic
1069777928 10:70937662-70937684 GGACAGAACCAGAGGGAGGGCGG + Intergenic
1070286076 10:75084941-75084963 GCGCAGCTCTGCTGGGAGGGTGG - Intergenic
1072458924 10:95601944-95601966 GGGCAGAGCTATAGAGATGGAGG - Intergenic
1073271064 10:102264641-102264663 GGGCAGACAGACAGGGAGGGGGG - Intronic
1073700483 10:105921229-105921251 GGCCAAATGTACAGGGAAGGCGG - Intergenic
1077074567 11:694549-694571 GGGCAGGTGTGCAGGGCGGGTGG + Intronic
1077074584 11:694602-694624 GGGCAGGTGTGCAGGGCGGGTGG + Intronic
1077366927 11:2165022-2165044 GGGCAGACCTACAGGACTGGGGG - Intronic
1078099249 11:8319999-8320021 GGGCAGAGCTACAGAGGTGGTGG + Intergenic
1078715612 11:13836437-13836459 GGGGAGTCCTGCAGGGAGGGAGG + Intergenic
1079353327 11:19711937-19711959 AAGCAGTTCTACAGGGTGGGAGG + Intronic
1079586116 11:22128469-22128491 CTGCAGAGCTACAGGGACGGAGG - Intergenic
1080899286 11:36472487-36472509 GGGCCCATCTTCAGGGTGGGAGG + Intergenic
1081963947 11:47158121-47158143 GGGCAGGGCTGCAGGCAGGGAGG - Intronic
1082763687 11:57149802-57149824 GGGCAGATATGCAGGGAGTGGGG - Intergenic
1083293115 11:61700698-61700720 GTGCAGGACTGCAGGGAGGGAGG - Intronic
1083419745 11:62546158-62546180 GGGCAGAGGTGCAGGGAGCGCGG + Intronic
1085524309 11:77155363-77155385 GGGCAGTGCTACAGAGAGTGGGG + Intronic
1086336871 11:85809857-85809879 GGGCAGAACTTCAGGGGTGGAGG + Intronic
1088932614 11:114367263-114367285 GAGCTGTTCTACAGGGCGGGGGG - Intergenic
1089356887 11:117859789-117859811 GGTCAGATGTACTGGGAGAGAGG - Intronic
1089561533 11:119345739-119345761 GGGCAGATCTTCCGGGAGAAGGG - Intronic
1090189433 11:124758829-124758851 GGGCAGATTTCCAGCGAGGAGGG + Intronic
1090399327 11:126438917-126438939 GGGCAGTTGTGCAGGGAGGGTGG - Intronic
1091028015 11:132159240-132159262 GGGCACATATACAGGAAGAGTGG + Intronic
1091326165 11:134689829-134689851 GGGCAGAGCTCCTGGGAGGAAGG - Intergenic
1091652193 12:2318838-2318860 GGGCAGAGAGACAGGGAAGGAGG + Intronic
1092244054 12:6853093-6853115 AGGCAGAACTGCAGGAAGGGAGG - Intronic
1093715114 12:22372769-22372791 AGGCAGAACTACAGGGAGAGAGG + Intronic
1094598084 12:31883715-31883737 GGGCAGATCTTGAGGTAAGGAGG - Intergenic
1096494241 12:52030156-52030178 GGGGAGAGGGACAGGGAGGGCGG - Intronic
1097162446 12:57057514-57057536 GGGCAGAGCCACAGGCAGGCAGG + Exonic
1097323497 12:58250436-58250458 GGGCAGAGATGCAGGAAGGGAGG + Intergenic
1097342094 12:58450516-58450538 TGGCAGAAATACAGGGATGGAGG - Intergenic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1104420059 12:128627746-128627768 GAGCAGAGCTGCAGGGCGGGGGG - Intronic
1104498552 12:129263623-129263645 GGGCATATAGAGAGGGAGGGAGG + Intronic
1104703560 12:130925444-130925466 GGACAGATCTACAGGCAGTGGGG - Intergenic
1105265503 13:18810728-18810750 GGGCACATATGCAGGGAGGGAGG - Intergenic
1106899968 13:34345310-34345332 GGGCAGATGTGGAGGGAGGTGGG - Intergenic
1108317174 13:49248145-49248167 GGGCAGAGCGAAAGGTAGGGTGG - Intronic
1109517545 13:63464154-63464176 TGGCAGATCTATAGGCAGGCAGG - Intergenic
1112563336 13:100532594-100532616 GGGCAGAGCTGCAGGGAGAGGGG + Exonic
1114479241 14:23021643-23021665 GGGCAGAAAAACAGGGAGGAAGG - Intronic
1114575401 14:23708198-23708220 GGCCAGAGCTACACTGAGGGTGG - Intergenic
1115953684 14:38751327-38751349 GGGCTGATGTCCAGGGAAGGAGG + Intergenic
1118111946 14:62731812-62731834 GGGCAGAACCAAAGGGAAGGAGG - Intronic
1118487436 14:66227072-66227094 GTGCAGATCTCTAGGGAGTGAGG - Intergenic
1118752372 14:68816532-68816554 GGGCAGAGCGCCAAGGAGGGCGG - Intergenic
1118849285 14:69572207-69572229 AGGAAGGTCTACAGGAAGGGCGG - Exonic
1121917065 14:97844793-97844815 AGGCAGAGAGACAGGGAGGGAGG + Intergenic
1122049149 14:99043301-99043323 AGGCTCATCTCCAGGGAGGGAGG + Intergenic
1122918746 14:104870963-104870985 GGGCAGGTGCACAGGGAGTGAGG - Intronic
1122978761 14:105181707-105181729 GGGCAGCCCCCCAGGGAGGGAGG + Intergenic
1202832995 14_GL000009v2_random:57390-57412 GGGCACACATGCAGGGAGGGAGG + Intergenic
1124250553 15:28104225-28104247 GGCCAGCTCCACAGGGTGGGAGG - Intergenic
1124885242 15:33679158-33679180 GGGAAGATTTACAGGGGGCGGGG - Intronic
1127054766 15:55120419-55120441 GGGAAGAGCTATAGGGAGGTAGG - Intergenic
1130412371 15:83657768-83657790 GGCCTGATCTTCAGGGAGTGTGG + Intronic
1130891792 15:88139673-88139695 GGTCAGAACTGCAAGGAGGGAGG + Intronic
1130995186 15:88899525-88899547 GGGAAGATCTAGAGGCAGAGCGG + Exonic
1131328192 15:91469184-91469206 GGGCAGCTCTCCTGGGTGGGAGG + Intergenic
1132055878 15:98649810-98649832 GGGCGGCTCTGCCGGGAGGGAGG + Intronic
1132279807 15:100602827-100602849 GGGCAGAGGTGCAGGGAGGCAGG - Exonic
1132326295 15:100973301-100973323 GGGCAGGTCTGGAGTGAGGGCGG + Intronic
1132548685 16:545295-545317 GGGCAGAAGGGCAGGGAGGGTGG + Intronic
1132677828 16:1127891-1127913 GGGCAGTTCTGCAGTTAGGGTGG + Intergenic
1132744621 16:1431552-1431574 GGGGAGGGCTTCAGGGAGGGAGG - Intergenic
1132777232 16:1601589-1601611 GGGCGAATCGACATGGAGGGTGG + Intronic
1132802179 16:1759821-1759843 CGCCCGATCTACAGGGAGCGGGG - Intronic
1132909401 16:2300746-2300768 GGGCAGAGCAGCAGGGAAGGTGG + Intronic
1132998695 16:2838227-2838249 GGGCTGATATGCAAGGAGGGAGG + Intronic
1134075834 16:11290674-11290696 GGGCAGATGTGGAGGCAGGGAGG + Intronic
1134742684 16:16561807-16561829 GGACAGATCCAGAGGGTGGGGGG - Intergenic
1134924875 16:18150657-18150679 GGACAGATCCAGAGGGTGGGGGG + Intergenic
1135170463 16:20179073-20179095 GGGCAGAGGAACAGGAAGGGAGG - Intergenic
1135745845 16:25015418-25015440 GGCCAGACCTAGAGGGCGGGCGG - Intronic
1136547773 16:30965308-30965330 GGCCAGAGATACAGGGAGTGAGG + Exonic
1136611976 16:31371863-31371885 GGGCTGAGCCACAGGGAGGCCGG - Intronic
1138331002 16:56215123-56215145 GGCCAGATCTACAGAGAAAGAGG - Intronic
1139700408 16:68704574-68704596 CGCCAGGTCTGCAGGGAGGGAGG + Intronic
1140140870 16:72256292-72256314 GGACAGGTCAACAGGCAGGGAGG + Intergenic
1141303806 16:82842041-82842063 AGGGAGAAATACAGGGAGGGAGG - Intronic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1141797873 16:86286899-86286921 GGGCAGAAAGACAGGGAGGCGGG - Intergenic
1142114347 16:88348563-88348585 GGGGAGCTGTACAGGGAGTGGGG + Intergenic
1142182287 16:88677102-88677124 GAGCAGGACTCCAGGGAGGGGGG + Intergenic
1142307794 16:89295259-89295281 GGGCAGAGGTCCAGGGAGAGCGG + Intronic
1142343829 16:89541450-89541472 GGGGAGGTCTCCAGGGAGGAGGG + Intronic
1142590495 17:1003345-1003367 GGGCAGAGCTGCGGGGAGGTGGG - Exonic
1142701768 17:1666869-1666891 AGGCAGATCTACAGAAAGGAGGG + Intronic
1145035455 17:19537461-19537483 GGGAAGACCTACAGGGAAGGTGG + Intronic
1146269997 17:31478627-31478649 GGCCAGGGCTCCAGGGAGGGAGG - Intronic
1148823997 17:50378684-50378706 GGGCAGAGCCAGAGGGTGGGAGG + Intronic
1149656645 17:58312625-58312647 GGCCAGCTCTGGAGGGAGGGAGG + Exonic
1151729848 17:75904777-75904799 GGGCAGCTCTGCGGGGGGGGGGG - Intronic
1152145542 17:78566490-78566512 GAGCTGATGTCCAGGGAGGGAGG - Intronic
1152754561 17:82081864-82081886 GGGCAGAGCTGCGGGGAGGTCGG + Intronic
1157551327 18:48583658-48583680 GGGCATATGAGCAGGGAGGGAGG + Intronic
1161286425 19:3470872-3470894 AGACAGATCTGGAGGGAGGGAGG + Intergenic
1161458019 19:4379671-4379693 GTGCAGAGGTGCAGGGAGGGCGG - Intronic
1161680409 19:5677283-5677305 GGGCAGGTCTAGGGTGAGGGAGG - Intronic
1161739410 19:6011406-6011428 GGCCAGGCCTACAGGGAGGCGGG + Intronic
1161849401 19:6730911-6730933 GGGCAGCTCTACGGGCAGGGTGG - Intronic
1162384354 19:10352544-10352566 GGGCATACCTAGGGGGAGGGGGG + Exonic
1162458868 19:10802607-10802629 GTTCAGATCTGCAGGGAGAGGGG + Intronic
1165395121 19:35559702-35559724 GGACAGATAGACAGGCAGGGAGG + Intronic
1165743238 19:38216064-38216086 GTGCAGACCTGGAGGGAGGGAGG - Intronic
1166944409 19:46388204-46388226 GGGCAGATCAGCAGAGAGGGTGG + Intronic
1167247671 19:48383422-48383444 GGGCAGATCCACAGGGAGGGAGG + Intronic
1202639682 1_KI270706v1_random:70335-70357 GGGCACACATGCAGGGAGGGAGG - Intergenic
925360714 2:3278440-3278462 GAGCAGCTCTGCACGGAGGGAGG - Intronic
925912719 2:8583813-8583835 AGCCAGAGCTCCAGGGAGGGGGG + Intergenic
926197299 2:10771730-10771752 GGGCAGTTCTCAAGGAAGGGTGG - Intronic
927155953 2:20221833-20221855 CTTCAGCTCTACAGGGAGGGTGG - Intronic
927859467 2:26551420-26551442 GGGCAGATGGGAAGGGAGGGAGG - Intronic
929868033 2:45734906-45734928 GGGGAGCTCTACAGCGAGGATGG - Intronic
931153623 2:59602919-59602941 GGGCAGGGCTCCAGGGAGGAGGG - Intergenic
932335815 2:70930873-70930895 GGGCAGGTGTACCGGCAGGGAGG - Intronic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
932780040 2:74554094-74554116 GGCCAGCTCCACGGGGAGGGAGG - Exonic
936615211 2:114041333-114041355 AGGCACATCTTCAGGAAGGGTGG + Intergenic
936926100 2:117738387-117738409 GGGTAGAGCTACAGGGCGGTAGG - Intergenic
936965365 2:118122665-118122687 GGGGAGAGCGAGAGGGAGGGAGG + Intergenic
938815739 2:134902431-134902453 GAGCAGATCTTCACAGAGGGTGG + Intergenic
942121677 2:172783843-172783865 GAGCAGATCTCTAGGGAGAGGGG + Intronic
942168991 2:173271292-173271314 GGGGAGGTCTCCAGGGAGGCAGG - Intergenic
942926361 2:181437806-181437828 AGGCAGACCCACAGGGAGGAAGG + Intergenic
943612638 2:190051765-190051787 AGGCATATCTACAAGTAGGGAGG + Intronic
946708885 2:222486249-222486271 GGGCAGATGTCCAGAGAGAGGGG - Intronic
947847818 2:233259738-233259760 GGGAAGATCTAGAGGGAAGAAGG - Intronic
949043708 2:241860727-241860749 GGGAAGAACTGCAGGGAGAGAGG - Intergenic
1169556537 20:6757135-6757157 GGGCAGATAGACAAGGTGGGGGG - Intergenic
1170706688 20:18750036-18750058 GGACAGATGTCCAGGCAGGGAGG + Intronic
1173223775 20:41149824-41149846 GGGCAGAGCTTCAAGGAGAGAGG + Intronic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1174220255 20:48948802-48948824 GGGAAGACGGACAGGGAGGGAGG - Intronic
1174680939 20:52407507-52407529 AGGAAGATGTAGAGGGAGGGCGG + Intergenic
1175505546 20:59481840-59481862 AGGCTGATCTACAGGAAGGGCGG - Intergenic
1175916995 20:62430623-62430645 GGGCTTGTCTGCAGGGAGGGTGG - Intergenic
1176427235 21:6556087-6556109 GGGCAGAGCTACAGGGCTGCTGG + Intergenic
1176648010 21:9367934-9367956 GGGCACACATGCAGGGAGGGAGG - Intergenic
1179492822 21:41752415-41752437 GAGCACATCTGCAGGGAGGTAGG + Intronic
1179540349 21:42079585-42079607 GGGCAGATCTAGAAGGAGGAAGG + Intronic
1179702726 21:43164405-43164427 GGGCAGAGCTACAGGGCTGCTGG + Intergenic
1180065570 21:45410463-45410485 GGCCAGAGCCACAGGGAGGAAGG + Intronic
1180185765 21:46138499-46138521 GGTCAGACCTCCAGGTAGGGGGG - Exonic
1180362261 22:11911535-11911557 GGGCACACATGCAGGGAGGGAGG + Intergenic
1182512433 22:30828737-30828759 GGGCAGGCCTACAGGTAGAGAGG + Intronic
1183629116 22:39022552-39022574 GGGCAGAAATACTGAGAGGGTGG + Intronic
949241312 3:1875936-1875958 GGGCACTTATACAGGGAGGAAGG + Intergenic
950257181 3:11515063-11515085 GGGCAGATCACCAGGTAAGGAGG - Intronic
950401578 3:12773169-12773191 GGGAAGAAGTAAAGGGAGGGAGG + Intergenic
950882707 3:16336064-16336086 GTGGAGATCTAGAGGCAGGGTGG + Intronic
952716612 3:36486349-36486371 GGGCAGGTCTGCAGGGAGTCAGG + Intronic
954466429 3:50657857-50657879 GGGCAGATGTGCAGGGAGACTGG + Intergenic
954791192 3:53134758-53134780 GGGCAGAGGAGCAGGGAGGGAGG + Intergenic
954848297 3:53578614-53578636 GCGGAGGTCTACAAGGAGGGTGG + Intronic
956438336 3:69256267-69256289 GGATAGATCTACATGGAGGTAGG + Intronic
956867509 3:73384242-73384264 GGGGAGATCTCCAGGGTGAGCGG + Exonic
959990006 3:112621086-112621108 GGGTATAGCTATAGGGAGGGGGG - Intronic
961167518 3:124773789-124773811 GGCCAGATCTGCAGCGAGCGTGG - Exonic
961372384 3:126439647-126439669 GGGCAGGTCCACAGTGAGGAAGG + Exonic
962269497 3:133967737-133967759 GGGCAGATGTGCAAGGAAGGAGG - Intronic
963607675 3:147424784-147424806 GGGCAGACCTGGAGGGAGGAGGG - Intronic
967034474 3:185637825-185637847 GGTCAGAGCTAGAGGGTGGGGGG + Intergenic
967304972 3:188051330-188051352 GGGCTTTTCTACAGGGAGTGAGG - Intergenic
967643286 3:191894609-191894631 TGGAAGAGCTACAGGGAGTGAGG - Intergenic
1202738875 3_GL000221v1_random:37053-37075 GGGCACACATGCAGGGAGGGAGG + Intergenic
968470963 4:782083-782105 GGGCGGATCTACTCGGGGGGCGG + Intergenic
968890354 4:3365388-3365410 GGACAGGTCTTGAGGGAGGGAGG + Intronic
969484780 4:7466264-7466286 GGGCAGAGCCACAAGGAGGCAGG - Intronic
970105342 4:12576399-12576421 GGGCAGATAAACAGTGAGGTGGG + Intergenic
971287934 4:25308204-25308226 AGGCAGGTCTACAGGGAGTGTGG + Intergenic
971500264 4:27311453-27311475 AGGGAGATCTAGAAGGAGGGAGG + Intergenic
972300129 4:37777440-37777462 TGGAAGAGCTACGGGGAGGGTGG - Intergenic
973369929 4:49236688-49236710 GGGCACACATGCAGGGAGGGAGG - Intergenic
973391102 4:49558724-49558746 GGGCACACATGCAGGGAGGGAGG + Intergenic
977020060 4:91747234-91747256 GGCCAGAACTCCAGGGAGGGGGG - Intergenic
977184084 4:93915629-93915651 TGGCAGAGCTACATGGTGGGAGG - Intergenic
977835382 4:101639706-101639728 GGGCAGCCCTGCAGGTAGGGAGG + Intronic
981044080 4:140250576-140250598 GGGAAGAGGTGCAGGGAGGGAGG + Intergenic
981747976 4:148069161-148069183 GGTCAGATCTTCAGAGAGGGAGG + Intronic
984782570 4:183539182-183539204 GAGAAGATCTACAGGCAGGTGGG - Intergenic
984853525 4:184173885-184173907 GGTCAGATCCACAGTGAGTGAGG + Intronic
1202767040 4_GL000008v2_random:156190-156212 GGGCACACATGCAGGGAGGGAGG - Intergenic
990326283 5:54678703-54678725 AGGAAGACCTTCAGGGAGGGAGG + Intergenic
992000572 5:72432330-72432352 TGGCAGACCTACACTGAGGGAGG - Intergenic
992215260 5:74519182-74519204 GGGCAGCTCTGCAGGGAGTGTGG - Intergenic
996344029 5:122470700-122470722 GGGCAGATAGAAAGGTAGGGTGG - Intergenic
997856704 5:137379121-137379143 AGGCATGTCTACAGGGATGGGGG + Intronic
997948526 5:138223457-138223479 GGGCACATATCCAGGGATGGAGG - Intergenic
1001953157 5:175830167-175830189 GGGCAGAGGGACAGGCAGGGAGG + Intronic
1001956009 5:175848567-175848589 GGACAGAGCCACAGGAAGGGTGG + Intronic
1002450866 5:179317840-179317862 GGGCTGGTCCACAGTGAGGGAGG + Intronic
1003558990 6:7165691-7165713 GGGCAGATGAGCAGGCAGGGCGG + Intronic
1003602108 6:7526994-7527016 GGGGAGATCTCCATGGAGGCTGG - Intergenic
1004265928 6:14148546-14148568 GGGCAGAATTCCAGTGAGGGTGG - Intergenic
1004325725 6:14672462-14672484 GGACAGATCTACAGGGAAAGTGG + Intergenic
1005480772 6:26253335-26253357 AGGCAGTTCTGGAGGGAGGGTGG + Intergenic
1006943509 6:37768606-37768628 GGGCAGCACTGCAGGGAGTGGGG + Intergenic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007717207 6:43864223-43864245 AGCCAGATTCACAGGGAGGGAGG - Intergenic
1007966037 6:46004501-46004523 TGGCAGAACTACAGGGTGGAGGG + Intronic
1009450068 6:63790282-63790304 AGAAAGATCTACAGGGAGGTAGG + Intronic
1012979811 6:105817576-105817598 TGGCAGATGTACAGTGTGGGTGG + Intergenic
1013633094 6:112003814-112003836 GGGGAGAAAAACAGGGAGGGAGG + Intergenic
1015425151 6:133056525-133056547 TGGCAGATCTTCAGGCAGCGTGG - Intergenic
1017293137 6:152764613-152764635 GAACAGATGTACATGGAGGGGGG - Intergenic
1019370339 7:659939-659961 GGGGAGATCTACAGGACTGGGGG - Intronic
1023584403 7:41714301-41714323 GGGCAGAAAAAGAGGGAGGGAGG + Intergenic
1023670303 7:42569634-42569656 GTGCAGTTCTACAGGGAAAGAGG + Intergenic
1026677617 7:72441249-72441271 GAGCAGACCTACAGGGAGGTGGG + Intronic
1026996341 7:74619371-74619393 GGGATGACCTACAGGGAGGTGGG - Intergenic
1033663500 7:143420066-143420088 GGCCAGACCTTCAGGGAGGACGG - Intergenic
1034516609 7:151585845-151585867 GAGCAGAAGTACAGGAAGGGAGG + Intronic
1036158225 8:6362356-6362378 GGGCAGATGAAGAGGGAGGGTGG - Intergenic
1036185808 8:6621737-6621759 GGACAGGTTTCCAGGGAGGGCGG + Intronic
1037015439 8:13900478-13900500 GGTCAGATTTAGAGGGAGTGAGG + Intergenic
1037632311 8:20669417-20669439 GGGCCTGTCTTCAGGGAGGGGGG - Intergenic
1039096002 8:33886128-33886150 TGAAAAATCTACAGGGAGGGAGG + Intergenic
1040579462 8:48685141-48685163 TGGCAGATATACAAGAAGGGAGG + Intergenic
1043586817 8:81779527-81779549 GGGGAGGTCAACGGGGAGGGAGG + Intergenic
1043938180 8:86167352-86167374 GGGAAGATCTACTTGGAGGTTGG - Intergenic
1047300513 8:123609758-123609780 TGGCAGCTCCACAGGGTGGGTGG + Intergenic
1048150755 8:131891132-131891154 GGGCAGAGTTGCAGGGAGCGAGG + Intergenic
1050009303 9:1169849-1169871 GGGCAGCCTAACAGGGAGGGGGG - Intergenic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1052876757 9:33573681-33573703 GGGCACACATGCAGGGAGGGAGG + Intergenic
1053152929 9:35754424-35754446 CGGCACAGCTAGAGGGAGGGAGG + Exonic
1053661967 9:40290600-40290622 GGACACACATACAGGGAGGGAGG + Intronic
1053912417 9:42920764-42920786 GGGCACACATACAGGGAGGGAGG + Intergenic
1054374093 9:64436836-64436858 GGACACACATACAGGGAGGGAGG + Intergenic
1054522642 9:66085684-66085706 GGACACACATACAGGGAGGGAGG - Intergenic
1055322985 9:75100348-75100370 GGGCACATGGACAAGGAGGGAGG - Intronic
1055502546 9:76916074-76916096 GGGCAGCTCTAAATGGAGGAAGG + Intergenic
1056239840 9:84633831-84633853 GGGCAGAATAACAGGGAGAGAGG + Intergenic
1056455736 9:86757611-86757633 GGGCAGTTCTACATGCAGGCTGG - Intergenic
1056586828 9:87932649-87932671 GGGCACACATGCAGGGAGGGAGG - Intergenic
1056610049 9:88120292-88120314 GGGCACACATGCAGGGAGGGAGG + Intergenic
1057162305 9:92897038-92897060 GGGCACACATGCAGGGAGGGAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057603715 9:96482657-96482679 GGCCAGGGCTGCAGGGAGGGAGG - Intronic
1058171805 9:101690508-101690530 GTGCAGAGCTGCAGGGAGAGAGG + Intronic
1058740479 9:107937608-107937630 GGGGTGATCTGGAGGGAGGGAGG + Intergenic
1060822036 9:126666804-126666826 GGGCAGGTATACAGGGATGAGGG + Intronic
1060828182 9:126698294-126698316 GGGCAGATGTGCTGGGAGAGAGG - Exonic
1060973650 9:127753035-127753057 GGGCAGAGCCAAGGGGAGGGAGG + Intronic
1061108869 9:128552766-128552788 GGGCAGCTCTTCAGGCGGGGCGG + Intronic
1061237211 9:129350138-129350160 CGGCAGATAAACGGGGAGGGGGG + Intergenic
1061918501 9:133769564-133769586 GGGCACAGCTACAGGCCGGGGGG + Intronic
1062052836 9:134456338-134456360 GGCCACGTCTACAGGGTGGGCGG - Intergenic
1062547144 9:137068992-137069014 GGGGAGCAGTACAGGGAGGGTGG + Intronic
1203707606 Un_KI270742v1:67497-67519 GGGCACACATGCAGGGAGGGAGG + Intergenic
1203547789 Un_KI270743v1:141067-141089 GGGCACACATGCAGGGAGGGAGG - Intergenic
1203666885 Un_KI270754v1:25318-25340 GAGCAGATTTCCAGCGAGGGAGG + Intergenic
1203668034 Un_KI270754v1:30957-30979 GAGCAGATTTCCAGCGAGGGAGG + Intergenic
1203669174 Un_KI270754v1:36594-36616 GAGCAGATTTCCAGCGAGGGAGG + Intergenic
1197822271 X:130553328-130553350 GAGGAAATCTACAGGGAGCGTGG + Intergenic
1199563156 X:149185809-149185831 TGGCAGAACTCCAGGGAAGGGGG + Intergenic
1199711123 X:150470433-150470455 GGGCAGAGCGACAGGGAGCATGG - Exonic
1199849112 X:151712608-151712630 GGGCAGATGGACAGGTAGGCAGG + Intergenic
1200071276 X:153530653-153530675 GGGCAGAGCTTCAGGCAGGTGGG + Intronic
1201319009 Y:12676931-12676953 GGGCAGATCAGGAGGGAGGTCGG + Intergenic