ID: 916440398

View in Genome Browser
Species Human (GRCh38)
Location 1:164819282-164819304
Sequence ATGGCTAATGGCCCTTCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916440393_916440398 1 Left 916440393 1:164819258-164819280 CCATCCCTGGGAGGTGAAAAGCA 0: 1
1: 0
2: 1
3: 22
4: 254
Right 916440398 1:164819282-164819304 ATGGCTAATGGCCCTTCTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 107
916440389_916440398 29 Left 916440389 1:164819230-164819252 CCTTAGGCTAACTCACTGGATGA 0: 1
1: 0
2: 0
3: 8
4: 71
Right 916440398 1:164819282-164819304 ATGGCTAATGGCCCTTCTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 107
916440395_916440398 -4 Left 916440395 1:164819263-164819285 CCTGGGAGGTGAAAAGCAGATGG 0: 1
1: 0
2: 0
3: 30
4: 279
Right 916440398 1:164819282-164819304 ATGGCTAATGGCCCTTCTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 107
916440394_916440398 -3 Left 916440394 1:164819262-164819284 CCCTGGGAGGTGAAAAGCAGATG 0: 1
1: 0
2: 0
3: 17
4: 225
Right 916440398 1:164819282-164819304 ATGGCTAATGGCCCTTCTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916440398 Original CRISPR ATGGCTAATGGCCCTTCTTG AGG Intronic
900512503 1:3067304-3067326 ATTGCTCATGGCCCTTCTCTAGG + Intergenic
906016704 1:42588278-42588300 AGTGCTAATGGCCCTTGTAGGGG + Intronic
916440398 1:164819282-164819304 ATGGCTAATGGCCCTTCTTGAGG + Intronic
916541759 1:165763495-165763517 ATGACTCATGGCATTTCTTGTGG - Intronic
919735862 1:200949991-200950013 ATGGCTAATGGCACTTGATTTGG + Intergenic
924056368 1:240127947-240127969 ATGGCTGATGGGACTTCTGGTGG + Intronic
1067297333 10:44982375-44982397 GTGGCTGATGGTCCTTCCTGAGG + Intronic
1068907481 10:62343370-62343392 ATGGCTAATGGCAGTTATGGGGG - Intergenic
1069243200 10:66168008-66168030 TTGGCCAATTGCCCTCCTTGTGG + Intronic
1069919808 10:71809746-71809768 AGGGCTCATGCCCCTTCCTGGGG + Intronic
1070965787 10:80529475-80529497 ATCACTAAGGGCCCTTCCTGAGG - Exonic
1073563284 10:104515288-104515310 CTGGCTAATGGCCATAGTTGTGG + Intergenic
1073637393 10:105213899-105213921 ATGCCTAATAGCCCTTTCTGTGG - Intronic
1077369012 11:2172873-2172895 GTGGCTTCTGGCCCTTCTGGTGG + Intergenic
1077920351 11:6637371-6637393 ATTGCTAATATCCCTTCTGGGGG + Intronic
1077926810 11:6689443-6689465 ATGGCTAATGGCAGTTATGGGGG + Intergenic
1078664682 11:13314781-13314803 ATACCTAGTGGCCCTTCATGGGG + Intronic
1078905769 11:15686519-15686541 ATAGCTTATTGCCCTGCTTGTGG - Intergenic
1079235439 11:18685477-18685499 ATGGCTAATGGCAGTTATGGGGG + Intergenic
1079361679 11:19775721-19775743 ATGTCTAATGGCACCTCTTCAGG - Intronic
1079950806 11:26801541-26801563 ATTGCTAATGCCCCTTTCTGTGG + Intergenic
1081299388 11:41431989-41432011 ATGGCCAATGGCCCCTCTAGCGG - Intronic
1087369639 11:97266587-97266609 ATGAATAATGTCCTTTCTTGAGG - Intergenic
1089187409 11:116628787-116628809 ATGGCTTAGTGCCCTTCCTGAGG - Intergenic
1099937945 12:89150524-89150546 TTGAATAATGGCCATTCTTGTGG - Intergenic
1101033519 12:100682914-100682936 GTGTCTAATTGCCCTTCTTTTGG + Intergenic
1102292076 12:111709117-111709139 TTGGCTAATGTCACATCTTGGGG - Intronic
1104286192 12:127426905-127426927 AAGGCTTATGGACCTTCTTTAGG - Intergenic
1106662242 13:31811496-31811518 ATGGCTTAGTGCCATTCTTGAGG + Intergenic
1108242090 13:48475439-48475461 ATGGCTATTGGCCCCTCTATTGG + Intronic
1109257611 13:60102187-60102209 ATGTGTAATGCCCTTTCTTGAGG - Intronic
1109464352 13:62709873-62709895 TTGGCTAATTGCCCTTGTTAGGG + Intergenic
1113524203 13:110961315-110961337 ATGGCTAATGGCAGTTATGGGGG + Intergenic
1115707271 14:36012271-36012293 TTTGATAATGGCCATTCTTGGGG + Intergenic
1116273921 14:42806100-42806122 ATGACTATAGGCCATTCTTGAGG - Intergenic
1121704857 14:95983866-95983888 CTGGCTACTGGCCGTTCTTTTGG - Intergenic
1140523585 16:75603362-75603384 ATGGCTGATGGCATTTCTTAAGG - Intronic
1143056524 17:4166628-4166650 TTGGCTGGTGGCCCTTCATGGGG + Exonic
1144481344 17:15631999-15632021 ATGACTAATTGTCCTTCTTTGGG + Intronic
1149872228 17:60193012-60193034 ATGGCAAATGCCCCTTCCTAGGG - Intronic
1150003336 17:61455343-61455365 AGGTCTGACGGCCCTTCTTGAGG - Intronic
1150348426 17:64422713-64422735 ATGGCTAATGGCAGTTATAGGGG + Intergenic
1153492357 18:5662782-5662804 ATTACTAATGGACCGTCTTGTGG - Intergenic
1157688028 18:49658676-49658698 CTGGCTTATGGCCTTTCATGAGG + Intergenic
1158220755 18:55148350-55148372 ATGTCTAATGGCCCATTTTCAGG + Intergenic
1160107010 18:75987600-75987622 ACGGCTAGTGGCCCTCCCTGGGG + Intergenic
1165327944 19:35125119-35125141 CTGGCTCCTGGCCCTACTTGGGG - Exonic
1168601203 19:57720107-57720129 ATGGCTATTGGCCTTTGCTGGGG - Exonic
926918826 2:17918991-17919013 AGGGCTAGGGGCCCCTCTTGTGG + Intronic
928382319 2:30829344-30829366 ATGGCTAATGGCATTTATGGGGG + Intergenic
934622901 2:95826388-95826410 ATGGCTGCTGTCCCTTCTTGGGG + Intergenic
934810870 2:97275715-97275737 ATGGCTGCTGTCCCTTCTTAGGG - Intergenic
934826822 2:97432224-97432246 ATGGCTGCTGTCCCTTCTTAGGG + Intergenic
942965597 2:181889804-181889826 AGGGATAATGGGTCTTCTTGAGG - Intergenic
943654729 2:190496296-190496318 TTTGATAATGGCCATTCTTGTGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947556212 2:231095731-231095753 ACGGCTAAAGGCCAATCTTGAGG + Intronic
947556329 2:231096527-231096549 ATGTCTAATGTACCTTCTTCGGG + Intronic
1177232284 21:18337739-18337761 CTGGCTAATAGCCTTTCTTTGGG - Intronic
1185032570 22:48452189-48452211 AGGGCTAATGATTCTTCTTGGGG + Intergenic
949998540 3:9638429-9638451 ATGGCTAATGGCACTTACGGGGG - Intergenic
950260809 3:11542531-11542553 ATGGGCCATGGCCCTTCCTGTGG + Intronic
950500231 3:13359027-13359049 ATGGCTCAGGGCCCATCTTGAGG + Intronic
953307343 3:41842507-41842529 ATGGCTTAATGCCATTCTTGTGG + Intronic
958177367 3:90013546-90013568 ATGTGTAATGCCCATTCTTGAGG + Intergenic
959249668 3:103925906-103925928 ATGGCTAATGGCACTTGCTGTGG - Intergenic
959808315 3:110586162-110586184 ATGGCTATTGTCCTTTTTTGTGG + Intergenic
967680636 3:192358770-192358792 ATGGCTAATCGTCTTACTTGGGG + Intronic
967873546 3:194251404-194251426 TTGGCTCATGGCCTTTCTGGAGG + Intergenic
968866330 4:3214588-3214610 GTGGCTAATGACCCTTGTTGAGG - Intronic
970502788 4:16695105-16695127 ATGGCTGAAGCCCCCTCTTGAGG - Intronic
973930882 4:55792127-55792149 ATGGCTTGCTGCCCTTCTTGTGG + Intergenic
977527177 4:98159563-98159585 ATGGCTAATGGCATTTATGGGGG + Intergenic
977589884 4:98814501-98814523 ATGGCTAATGGCAGTTATGGGGG + Intergenic
978675024 4:111302676-111302698 ATGGCCATTGGCACTTCTTGTGG + Intergenic
987999422 5:25330426-25330448 CTGGCTCATGGCCCTTCCTAGGG - Intergenic
992313602 5:75529341-75529363 ATGGCTTAGTGCCCTCCTTGTGG - Intronic
995182772 5:109244438-109244460 ATGGCTATTGTCCCTTCTGGAGG - Intergenic
996127931 5:119747920-119747942 ATGGCTAAGGGTGTTTCTTGCGG + Intergenic
996818744 5:127602171-127602193 TTGGCTCATGGCTCTTCTGGGGG + Intergenic
1000909234 5:167000878-167000900 CTGGCCAGTGGACCTTCTTGAGG + Intergenic
1003214139 6:4093613-4093635 ATCACTAATGGCACTTTTTGTGG - Intronic
1007967627 6:46016357-46016379 ATGGCAAATGCCCCTTTTGGTGG - Intronic
1008348143 6:50454873-50454895 ATGTCTAATGTCCATTCTTTTGG - Intergenic
1011294304 6:85809832-85809854 AAGGCTAAAGGCCCTTTTTTTGG + Intergenic
1011341600 6:86321464-86321486 ATGGCTAATGGCAGTTATGGTGG + Intergenic
1016199821 6:141394360-141394382 CTGGCTTGTGGCCCTTCCTGTGG - Intergenic
1017109677 6:150920459-150920481 ATGTCTAATGACCCATTTTGAGG - Intronic
1026647837 7:72187935-72187957 TTTGATAATGGCCATTCTTGTGG - Intronic
1031325567 7:120392716-120392738 ATGGCTTATGGCAGTTCTGGGGG - Intronic
1036116295 8:5963794-5963816 ATGGCTCCTGGCCCTTCTGCAGG - Intergenic
1039651622 8:39346539-39346561 CTGTCTAATGGGCCATCTTGCGG - Intergenic
1045737468 8:105313647-105313669 ATTGCTAGTGGCCATCCTTGTGG - Intronic
1046025068 8:108712501-108712523 ATGGCAGATGGGCCTCCTTGTGG + Intronic
1046672701 8:117074259-117074281 AAGCCTCATGGCCCTTCCTGTGG + Intronic
1047849846 8:128844906-128844928 ATGGCTACTGCCCATTCATGAGG - Intergenic
1055744989 9:79433758-79433780 CTGGCTTAGGGACCTTCTTGGGG + Intergenic
1056116242 9:83444183-83444205 AGGTCTAATGGCCCTGCTTCTGG - Intronic
1056884448 9:90427648-90427670 ATTGCTAATGCTCCTTCCTGTGG - Intergenic
1057052909 9:91939288-91939310 ATGCCAAATGGCCCTACCTGTGG + Intronic
1058112263 9:101043826-101043848 TTTGATAATGGCCATTCTTGAGG + Intronic
1058979409 9:110155424-110155446 CTGGCTTCTGGCCCTTCATGGGG - Intronic
1059690210 9:116677505-116677527 ATGGCTAATAGCACTTATGGAGG + Intronic
1059924488 9:119194645-119194667 ATGGCTAGGGGCCCTTCTCCAGG - Intronic
1060973211 9:127750594-127750616 ATGGCTAATGGCCCAGGGTGGGG - Intronic
1061712223 9:132496458-132496480 ATGGCTAAGGGGCGTTCTTTGGG - Intronic
1186348870 X:8722880-8722902 TTTGATAATGGCCATTCTTGCGG + Intronic
1187239638 X:17501047-17501069 AGAGCTAATAGCCCTTCTTGAGG + Intronic
1188587577 X:31796778-31796800 ATGGCTTAATGCCCTTCCTGGGG + Intronic
1189073080 X:37885997-37886019 ATGGCTAATGGCAGTTATGGGGG - Intronic
1189086430 X:38030170-38030192 AAGGCTAATGGCAGTTATTGGGG - Intronic
1192497622 X:71626715-71626737 CTGGCTAAGGCCCCTTCCTGAGG + Intergenic
1193486466 X:82090285-82090307 ATGGCTAATGGCAGTTATGGAGG + Intergenic
1195219886 X:102736773-102736795 ATGGCTAATGGCAGTTATGGAGG - Intronic
1195519840 X:105818496-105818518 TAGGCTAAAGGACCTTCTTGAGG - Intergenic
1196024754 X:111029749-111029771 ATGACTAATGGCACTTCGTGTGG + Intronic
1199206332 X:145153188-145153210 TTTGCTTATGGCCATTCTTGCGG - Intergenic