ID: 916444266

View in Genome Browser
Species Human (GRCh38)
Location 1:164857352-164857374
Sequence CACAGGAGCCTCTAACCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1487
Summary {0: 1, 1: 0, 2: 5, 3: 91, 4: 1390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916444257_916444266 21 Left 916444257 1:164857308-164857330 CCAAACAGAGAGGCACATAGTGG 0: 1
1: 0
2: 0
3: 12
4: 141
Right 916444266 1:164857352-164857374 CACAGGAGCCTCTAACCCCATGG 0: 1
1: 0
2: 5
3: 91
4: 1390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916444266 Original CRISPR CACAGGAGCCTCTAACCCCA TGG Intronic
900050087 1:589342-589364 CACAGCAGCCTCAAACTCCTAGG + Intergenic
900138782 1:1130306-1130328 CACAGGAGCCTCCCAGCACACGG - Intergenic
900295240 1:1945750-1945772 CACTTCAGCCTCTAACCCCTGGG - Intronic
900315197 1:2052787-2052809 GACAGCAGCGTCTCACCCCAGGG - Intronic
900638483 1:3676933-3676955 CACAGCACCCTCTGACCCCGTGG + Intronic
901487791 1:9577353-9577375 CCCGGGAGCCTGTAATCCCAGGG + Intronic
901696259 1:11010439-11010461 CACTGCAACCTCTAACTCCAGGG - Intergenic
901827545 1:11872240-11872262 CACCGCAGCCTCAAACCCCTGGG + Intergenic
902215614 1:14932556-14932578 CATGGGAGCCTCTAGCCACATGG - Intronic
902292426 1:15444179-15444201 CACTGCAGCCTCAAACCCCTGGG - Intronic
902305868 1:15538639-15538661 CACAGCAACCTCCAACTCCAGGG - Intronic
902520864 1:17015304-17015326 CACGGCAGCCTCTAACTCCTGGG + Intergenic
902854853 1:19194410-19194432 CACTGTAGCCTCAAACCCCTGGG - Intronic
902915731 1:19638122-19638144 CACTGCAGCCTCTAACTCCTGGG + Intronic
903075764 1:20764797-20764819 CACTGCAGCCTCTAACTCCCGGG - Intronic
903134096 1:21297911-21297933 CACTGCAGCCTCTAAACTCATGG + Intronic
903145056 1:21366232-21366254 CACTGCAGCCTCTAACTCCTGGG - Intergenic
903175884 1:21580343-21580365 CACTGCAGCCTCTAACTCCTGGG - Intergenic
903232751 1:21931758-21931780 CTCCTGAGCCTCTCACCCCAAGG + Intronic
903258846 1:22120460-22120482 CACAGGAGCCTGACACCCCGTGG + Exonic
903422543 1:23228534-23228556 CACTGCAGCCTCTAACTCCTGGG - Intergenic
903424289 1:23241870-23241892 CACTGCAGCCTCAAACCCCTGGG + Intergenic
903602812 1:24554862-24554884 CACTGCAGCCTCTAACTCCTGGG - Intergenic
903615991 1:24657154-24657176 CACTGCAGCCTCCAACCCCTGGG + Intronic
903630133 1:24762346-24762368 CACCGTAGCCTCTAACTCCTGGG - Intronic
903760749 1:25696720-25696742 CACTGCAGCCTCTAACTCCTGGG + Intronic
903807527 1:26016187-26016209 CACAGCAGCCTCAAACTCCTGGG - Intergenic
903853782 1:26323692-26323714 CACTGCAGCCTCTAACTCCTGGG + Intronic
903895643 1:26601806-26601828 CACTGCAGCCTCTAACTCCTGGG - Intergenic
903950354 1:26993031-26993053 CAGAGGAGCCCCGGACCCCACGG - Intergenic
904055498 1:27667338-27667360 CACAGCAGCCTCGAACTCCCAGG - Intronic
904062196 1:27720485-27720507 CACTGCAGCCTCTAACTCCTGGG + Intergenic
904763306 1:32820898-32820920 CACTGCAGCCTTGAACCCCAGGG - Intronic
904784738 1:32974971-32974993 CACAGGAGCCCCTCACCTCCCGG + Intergenic
904790308 1:33015406-33015428 CACAGGAGCCTAGAAACCTAAGG + Intronic
904908067 1:33912886-33912908 CACTGCAGCCTCTACCTCCAGGG + Intronic
905075157 1:35264240-35264262 CACTGGAGCCTCAAACTCCTGGG - Intergenic
905093341 1:35447645-35447667 CACTGCAGCCTCAAACCCCTGGG + Intronic
905250007 1:36642295-36642317 CACTGCAGCCTCTAACTCCCCGG - Intergenic
905283760 1:36865953-36865975 CACGGTAGCCTCTAACTCCTGGG + Intronic
905573435 1:39024636-39024658 CACTGCAGCCTCAAACTCCAGGG - Intergenic
905588340 1:39140027-39140049 CACAGCAGCCTCAAACTCCTGGG + Intronic
905735394 1:40321631-40321653 CACTGCAGCCTCAAACTCCAGGG - Intergenic
905854416 1:41298719-41298741 CACAGTAGCCTCTAACTCCTGGG + Intergenic
906102588 1:43272730-43272752 AACAGGAGGCTCAAGCCCCAGGG + Exonic
906205526 1:43984558-43984580 CACAGGTACTGCTAACCCCAAGG + Intronic
906485496 1:46231560-46231582 CACTGCAGCCTCTACCTCCAGGG + Intergenic
906496366 1:46306959-46306981 CACTGCAGCCTCAAACCCCTGGG + Intronic
907195523 1:52683428-52683450 CACTGCAGCCTCTAACTCCTGGG - Intergenic
907689107 1:56645131-56645153 CGCAGGAGCCTCTCACTCCCGGG + Intronic
907709772 1:56868540-56868562 CACAGCAGCCTCAAACTCCTGGG - Intronic
908050462 1:60224272-60224294 CACAGCAGCCTCTAACCCCTGGG + Intergenic
908357924 1:63340371-63340393 CACTGCAGCCTCAAACCCCCAGG - Intergenic
908530475 1:65029170-65029192 CACTGCAGCCTCAAACTCCAGGG + Intergenic
908530925 1:65033227-65033249 CACTGCAGCCTCTAACTCCTGGG + Intergenic
908572897 1:65427481-65427503 CACTGCAGCCTCCAACCCCTGGG - Intronic
908818336 1:68057104-68057126 CATAGGAGACTTTAGCCCCAGGG + Intergenic
909600660 1:77458024-77458046 CACTGCAGCCTCTAACTCCTAGG - Intronic
909621880 1:77677260-77677282 CACTGCAGCCTCTACCCCCCGGG - Intronic
909761567 1:79294330-79294352 CACAGCAGCCTCTACCTCCAGGG + Intergenic
910220638 1:84886448-84886470 CACTGCAGCCTCTAACTCCTAGG - Intronic
910289574 1:85587458-85587480 CATTGGAGCCTTTAACCCAAGGG - Intergenic
910306089 1:85765663-85765685 CACTGGAGCCTCGAACTCCTGGG - Intronic
910406342 1:86894759-86894781 CACAGCAGCCTCCAACTCCAGGG - Intronic
910667570 1:89741549-89741571 TACAGGAGCTTCTGTCCCCATGG + Intronic
911348295 1:96722235-96722257 CACAGGCACCGCTAACCCAAGGG - Intronic
911767437 1:101694469-101694491 CACTGGAGCCTCCACCTCCAAGG - Intergenic
912828637 1:112929941-112929963 TACAGGAGCCTCTTCCCCCGTGG - Intronic
913008856 1:114662882-114662904 CACTGCAGCCTCCAACCCCTGGG - Intronic
913366504 1:118045470-118045492 CACAAGAGCTTCTGTCCCCATGG - Intronic
913367576 1:118058281-118058303 CACAGGTGCCTCAAACTCCTGGG + Intronic
914258590 1:145980199-145980221 CACCGCAGCCTCAAACTCCAGGG - Intergenic
914705676 1:150167767-150167789 CACTGCAGCCTCCAACCCCTGGG - Intergenic
914812376 1:151038296-151038318 CACTGCAGCCTCTACCTCCAGGG - Intronic
914865079 1:151420110-151420132 CACTGCAGCCTCGAACCCCTGGG - Intronic
915316605 1:155032374-155032396 CACTGCAGCCTCAAACCCCTGGG + Intronic
915366171 1:155317766-155317788 CACTGTAGCCTCTAACTCCCAGG - Intronic
915380987 1:155440230-155440252 CACTGCAGCCTCAAACTCCATGG - Intronic
915395857 1:155583460-155583482 CACTGCAGCCTCTAACTCCTAGG - Intergenic
915408363 1:155680100-155680122 CACAGCAGCCTCGACCTCCAGGG - Intronic
915749168 1:158188615-158188637 CACAGCAGCCTCGAACTCCTGGG + Intergenic
916123864 1:161551863-161551885 CACTGTAGCCTCTAACTCCGGGG - Intergenic
916127128 1:161581507-161581529 CACAGAAGCATATGACCCCAAGG - Intronic
916133748 1:161633226-161633248 CACTGTAGCCTCTAACTCCGGGG - Intronic
916137048 1:161663311-161663333 CACAGAAGCATATGACCCCAAGG - Exonic
916232443 1:162553888-162553910 CACTGCAGCCTCAAACTCCAGGG + Intergenic
916422354 1:164648841-164648863 AGCAGGGGCCTCTAGCCCCAGGG + Intronic
916444266 1:164857352-164857374 CACAGGAGCCTCTAACCCCATGG + Intronic
916531487 1:165660742-165660764 CACAGGAGCCTCTGTTCCCGTGG + Intronic
916570316 1:166019730-166019752 CACAACAGCCTCTGACCCTAGGG - Intergenic
917310788 1:173675536-173675558 CACAGCAACCTCTACCCCCTGGG - Intergenic
917343778 1:174007537-174007559 CACTGCAGCCTCAAACCCCTGGG + Intronic
917426385 1:174918939-174918961 CACTGCAGCCTCTAACTCCTAGG - Intronic
917571483 1:176270063-176270085 CACTGCAGCCTCTAACTCCTGGG - Intergenic
917892168 1:179450846-179450868 CACTGCAGCCTCTAACTCCTGGG - Intronic
918145789 1:181754407-181754429 CACAGGACAATCTAGCCCCACGG - Intronic
918244767 1:182649171-182649193 CACAGGTGTCTCTATCCCCTGGG + Intronic
918282284 1:183018961-183018983 CACTGCAGCCTCCAACTCCAGGG - Intergenic
918299000 1:183185550-183185572 CACTGCAGCCTCCAACCCCTGGG - Intergenic
918306840 1:183254511-183254533 CACTGGAGCCTCAAACTCCTGGG + Intronic
918508423 1:185283080-185283102 AACAGGAGCCTCTGTCCCCATGG + Intronic
918686870 1:187428213-187428235 CACAGGAGCTTCTGTCCCTATGG + Intergenic
919490939 1:198204182-198204204 CACTGCAGCCTCTAACTCCTGGG - Intronic
919568549 1:199218934-199218956 CACAAGAGACTTTAACCCTAGGG - Intergenic
919680754 1:200432181-200432203 CACAGCAGCCTCAACCTCCAGGG - Intergenic
919725953 1:200884076-200884098 CCCAGAAGCCTCTCACCCAAAGG - Intergenic
919919229 1:202158434-202158456 CACAGCAGCCTCAAACTCCTGGG + Intronic
919991524 1:202710797-202710819 CTCAGGAGCCCCCATCCCCATGG + Intergenic
920168219 1:204051435-204051457 CACGGCAGCCTCCAACCCCTGGG + Intergenic
920352627 1:205347637-205347659 CACTGAAGCCTCTACCCCCTGGG - Intronic
920626776 1:207610406-207610428 CACTGAAGCCTCTAACTCCTGGG + Intronic
920808144 1:209254465-209254487 GACAGGAGCTTCTGTCCCCATGG - Intergenic
921426840 1:215012545-215012567 CACAGCAGCCTCTAACTTCTGGG + Intronic
921595736 1:217051836-217051858 CACTGCAGCCTCTAACTCCTGGG + Intronic
921653154 1:217703244-217703266 CACTGCAACCTCTAACCCCCAGG + Intronic
921970238 1:221140440-221140462 CACTGGAGCCTCAAACTCCAGGG + Intergenic
922541061 1:226420325-226420347 CACTGTAGCCTCTAACTCCTGGG + Intergenic
922601383 1:226857385-226857407 CACAGGAGCTTCTGTCTCCATGG - Intergenic
922688887 1:227671150-227671172 CACTGGAGCCTCAAACTCCTGGG + Intronic
922866325 1:228864241-228864263 CACTGCAGCCTCAAACCCCTGGG + Intergenic
922981938 1:229834394-229834416 CACTGCAGCCTCAAACCCCTGGG - Intergenic
923206322 1:231762408-231762430 CACTGCAGCCTCTAACTCCTGGG + Intronic
923430585 1:233916341-233916363 CACTGCAGCCTCTAACTCCTGGG + Intronic
923469503 1:234278115-234278137 CACTGCAGCCTCCAACCCCCAGG - Intronic
923489125 1:234467845-234467867 CACTGCAGCCTCAAACTCCAGGG + Intronic
923500042 1:234557022-234557044 CACATGAGCCTCTGTCCCCATGG + Intergenic
923534007 1:234834555-234834577 CACAGCAGCCTCAAACCCCCAGG + Intergenic
923543906 1:234910053-234910075 CACTGCAGCCTCAAACCCCTGGG + Intergenic
923992189 1:239451146-239451168 CACTGCAGCCTCCAACCCCCGGG - Intronic
924331622 1:242946025-242946047 CATAGGAGACTTTAACCCTAGGG + Intergenic
924461940 1:244267302-244267324 CACTGCAGCCTCGAACTCCAGGG - Intergenic
924464013 1:244284230-244284252 CACTGCAGCCTCTAACTCCTGGG + Intergenic
924474787 1:244373425-244373447 CACTGTAGCCTCTAACTCCTGGG - Intronic
924514355 1:244753717-244753739 CACTGCAGCCTCTAACTCCTGGG + Intergenic
924559770 1:245148263-245148285 CACTGCAGCCTCGAACCCCTGGG + Intergenic
924606796 1:245542275-245542297 CACTGCAGCCTCTAACTCCTGGG - Intronic
1062995051 10:1857883-1857905 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1063493799 10:6488853-6488875 CACTGCAGCCTCAAACCCCTGGG + Intronic
1063501205 10:6556354-6556376 CACTGTAGCCTCTAACTCCTGGG - Intronic
1063563921 10:7155381-7155403 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1063601536 10:7485728-7485750 CACAGCAGCACCTAACACCATGG + Intergenic
1063689378 10:8271847-8271869 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1063706340 10:8434656-8434678 CACTGCAGCCTCTGACCCCCTGG + Intergenic
1063855879 10:10253154-10253176 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1063890404 10:10622577-10622599 CACAGTAGCCTCTACCTCCTGGG - Intergenic
1063903260 10:10757381-10757403 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1064002743 10:11677217-11677239 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1064079307 10:12295530-12295552 CACAGCAGCCTCGAACTCCTGGG + Intergenic
1064183083 10:13136109-13136131 CACTGCAGCCTCTAACTCCTGGG - Intronic
1064420717 10:15188117-15188139 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1064582275 10:16806827-16806849 CACTGGAGCCTCTACCTCCCAGG + Intronic
1064666745 10:17660673-17660695 CACTGCAGCCTCTAACTCCTGGG - Intronic
1064674449 10:17747355-17747377 CACTGCAGCCTCGAACCCCTGGG + Intergenic
1064731080 10:18331376-18331398 CACTGCAGCCTCAAACCCCTAGG - Intronic
1064852310 10:19722512-19722534 CACAGCAGCCTCCAACTCCTGGG - Intronic
1064899930 10:20284511-20284533 CACAGCAGCCTCTAACTCATGGG - Exonic
1064997175 10:21306492-21306514 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1065280677 10:24134647-24134669 CACTGCAGCCTCGAACCCCTGGG + Intronic
1065295379 10:24269446-24269468 CACAGCAGCCTCAAACTCCAGGG - Intronic
1065295911 10:24275011-24275033 CACTGGAGCCTCAAACTCCTGGG + Intronic
1065322359 10:24521429-24521451 CACTGGAGCCTCAAACACCTGGG - Intronic
1065506198 10:26432450-26432472 CACTGCAGCCTCTAATTCCAGGG - Intergenic
1065519587 10:26558699-26558721 CACTGCAGCCTCTAACTCCTGGG - Intronic
1065625196 10:27623078-27623100 CACTGGAGCCTCAAACTCCTTGG + Intergenic
1065626210 10:27631496-27631518 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1065729579 10:28698825-28698847 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1065738322 10:28773723-28773745 CACTGCAGCCTCTAACTCCTAGG - Intergenic
1065849451 10:29774997-29775019 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1065903467 10:30228220-30228242 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1066195258 10:33093042-33093064 CACTGAAGCCTCTAACTCCTGGG + Intergenic
1066357810 10:34701823-34701845 CACTGTAGCCTCGAACCCCTGGG - Intronic
1066377107 10:34867452-34867474 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1066416796 10:35229154-35229176 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1066481947 10:35805023-35805045 CACTGCAGCCTTGAACCCCAGGG + Intergenic
1066628741 10:37437418-37437440 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1067481798 10:46605567-46605589 CACTGTAGCCTCTAACTCCTGGG + Intergenic
1067612953 10:47736162-47736184 CACTGTAGCCTCTAACTCCTGGG - Intergenic
1067909382 10:50330407-50330429 CACTGTAGCCTCTAACTCCCAGG - Intronic
1068984621 10:63095711-63095733 CACTGCAGCCTCTAACGCCTGGG - Intergenic
1068995927 10:63204037-63204059 CACAGCAGCCTCCAACTCCTGGG - Intronic
1069104890 10:64371733-64371755 CACAGAAACCTCTAATACCATGG - Intergenic
1069569626 10:69486512-69486534 CACTGCAGCCTCGAACCCCTGGG + Intronic
1069609575 10:69763859-69763881 CACAGGAGCTTCTGTCCCCATGG + Intergenic
1069656399 10:70092355-70092377 CACTGCAGCCTCTAACTCCTAGG - Intronic
1069660296 10:70119129-70119151 CACAGGGGCTTCTGTCCCCATGG - Intronic
1069666258 10:70162262-70162284 CACTGCAGCCTCAAACCCCTGGG - Intronic
1070099356 10:73370158-73370180 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1070313605 10:75291533-75291555 CACTGCAGCCTCGAACCCCTGGG - Intergenic
1070316344 10:75317015-75317037 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1070384196 10:75909367-75909389 AACAGGAGCCTCTAGGCTCATGG + Intronic
1070674438 10:78402589-78402611 CACTGCAGCCTCAAACGCCAAGG - Intergenic
1071539374 10:86466492-86466514 CACTGCAGCCTCAAACCCCTGGG - Intronic
1071628370 10:87196265-87196287 CACTGTAGCCTCTAACTCCTGGG - Intergenic
1071798823 10:89035050-89035072 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1072101159 10:92230727-92230749 CACAGGAGCAGCTACCCACAAGG + Intronic
1072189566 10:93068889-93068911 CAGAGAAGCATCTAAGCCCATGG + Intergenic
1072292893 10:93981450-93981472 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1072411040 10:95202216-95202238 CACATAAGCCTCCAACCCCTGGG - Intronic
1072495450 10:95953276-95953298 CACTGCAGCCTCTAACTCCTGGG + Intronic
1072497665 10:95978431-95978453 CATAGCAGCCTCAAACTCCAGGG + Intronic
1072798915 10:98378347-98378369 CACTGTAGCCTCCAACCCCTGGG + Intergenic
1073071633 10:100798189-100798211 CACTGCAGCCTCCATCCCCAGGG + Intronic
1073232474 10:101983709-101983731 CCCAGGAGCTTCTGACCCCATGG - Intronic
1073283759 10:102374507-102374529 CACAGCAGCCTCAAACTCCTGGG - Intronic
1073416005 10:103382721-103382743 CACTGCAGCCTCTAATCCCTGGG + Intronic
1073671547 10:105596060-105596082 CACTGCAGCCTCGAACCCCTGGG - Intergenic
1074299764 10:112223112-112223134 CAGAGGAGCCTCAGACCACAGGG - Intergenic
1074373172 10:112916967-112916989 CACTGTAGCCTCTAACTCCTGGG - Intergenic
1074657004 10:115602276-115602298 CACTGCAACCTCTGACCCCAGGG - Intronic
1075049557 10:119172839-119172861 CACAGCAGCCTCAAACTCCTGGG + Intronic
1075099169 10:119493872-119493894 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1075500599 10:122970276-122970298 CACTAGAGCCTCGAACTCCAGGG - Intronic
1075631410 10:124002867-124002889 CCCAGGTGCCTCTAATACCAAGG + Intergenic
1075875762 10:125804348-125804370 CACAGGAGCTTCTTCCCCCATGG - Intronic
1076019145 10:127056278-127056300 CACTGCAGCCTCAAACCCCTGGG + Intronic
1076567471 10:131408757-131408779 CACTGCAGCCTCGAACCCCCAGG + Intergenic
1076767281 10:132643422-132643444 CACAGCAGCCTCCAACTCCTGGG - Intronic
1077057389 11:601351-601373 CACAGCAGCCTCCAACTCCTGGG - Intronic
1077120854 11:907757-907779 CTCAGGAGCCTGTGACCCAAGGG - Intronic
1077270548 11:1677235-1677257 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1077348466 11:2076369-2076391 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1077628593 11:3795368-3795390 CACAGTAGCCTCTACCTCCTGGG - Intronic
1078321166 11:10336137-10336159 CACAGCAACCTCTAACTCCTGGG + Intronic
1078766788 11:14305967-14305989 CACTGCAGCCTCTAACTCCTGGG - Intronic
1079207164 11:18426089-18426111 CACTGCAGCCTCTAACTCCTGGG + Intronic
1080010853 11:27458052-27458074 CACTGCAGCCTCTAACTCCTGGG - Intronic
1080541365 11:33268513-33268535 CACTGCAGCCTCTAACTCCTAGG - Intronic
1080543220 11:33289367-33289389 CACTGTAGCCTCTAACACCTGGG - Intronic
1080639456 11:34150258-34150280 CACTGCAGCCTCGAACCCCTGGG + Intergenic
1081724003 11:45313742-45313764 TGCAGGAGCCTCTGTCCCCAGGG - Intergenic
1081844168 11:46226831-46226853 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1081933919 11:46891689-46891711 CACTGCAGCCTCGAACTCCAGGG + Intronic
1082862460 11:57869077-57869099 CACTGCAGCCTCGACCCCCAAGG + Intergenic
1083039677 11:59673460-59673482 CACAGCAGCCTCAAACCCCTGGG + Intergenic
1083084260 11:60126183-60126205 CACAGGAGCTTCTGTCCTCATGG + Intergenic
1083242159 11:61396856-61396878 CACTGCAGCCTCGAACCCCTGGG - Intronic
1083604212 11:63967968-63967990 CACAGCAGCCTCTATCTCCCAGG + Intergenic
1083845843 11:65333182-65333204 CACTGGAGCCTCAAACTCCTGGG + Intergenic
1083909006 11:65694456-65694478 CCCTGGAGCCTCTAAGCACATGG + Intergenic
1083952112 11:65962251-65962273 CACTGCAGCCTCTAACTCCTGGG - Intronic
1083967851 11:66053594-66053616 CACTGCAGCCTCCAACCCCAGGG - Intronic
1084078052 11:66797578-66797600 CACTGCAGCCTCTACCTCCAAGG + Intronic
1084103430 11:66965079-66965101 CCCAGGCTCCTTTAACCCCATGG - Intergenic
1084622238 11:70280641-70280663 CACTGCAGCCTCAAACTCCAGGG + Intronic
1084695416 11:70750814-70750836 CAAATGAGCTTCTAACCCCTTGG - Intronic
1084759131 11:71257289-71257311 CACAGGAGCCTCAACTCACATGG - Intergenic
1084759846 11:71263182-71263204 CACTGCAGCCTCGAACCCCTGGG - Intergenic
1084768591 11:71327971-71327993 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1084806658 11:71583910-71583932 CACTGCAGCCTCTAACTCCTGGG + Intronic
1085182472 11:74547270-74547292 CACTGCAGCCTCAAACTCCACGG - Intronic
1085426070 11:76405727-76405749 CACTGCAGCCTCCAACTCCATGG + Exonic
1085553051 11:77393368-77393390 CACTGCAGCCTCAAACTCCAGGG + Intronic
1086463974 11:87034919-87034941 CACAGCAGCCTATATCCCCTGGG - Intergenic
1087033689 11:93733687-93733709 CACTGTAGCCTCGAACCCCTGGG - Intronic
1087757279 11:102067829-102067851 CACAGCAGCCTCAAACTCCTGGG - Intronic
1087759825 11:102093715-102093737 CACTACAGCCTCTAACTCCAGGG + Intergenic
1087994896 11:104793297-104793319 CACAGGAGCTTCTGTGCCCAAGG - Intergenic
1088214843 11:107496570-107496592 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1088238161 11:107747249-107747271 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1088529605 11:110794227-110794249 CACTGCAGCCTCTATCCCCTGGG + Intergenic
1088646497 11:111920686-111920708 CACTGCAGCCTCTACCCCCAGGG - Intronic
1088649007 11:111941037-111941059 CACTGCAGCCTCTAACTCCTAGG - Intronic
1089222330 11:116884260-116884282 CACTGTAGCCTCGAACCCCTGGG + Intronic
1089450037 11:118587993-118588015 CACAGGAGCTTCTGTCCCCAGGG + Intronic
1089846233 11:121460766-121460788 CACAGGTGGCTCTTAACCCAGGG - Intronic
1090213568 11:124940661-124940683 CACAGGGGCCTCTCATGCCATGG - Intergenic
1090348800 11:126093171-126093193 CACAGCAGCCTCAAACTCCTAGG + Intergenic
1091529481 12:1340308-1340330 CATAGGAGACTTTAGCCCCAGGG - Intronic
1092079492 12:5703613-5703635 CACTGCAGCCTCTAACTCCTAGG + Intronic
1092187155 12:6489079-6489101 CACTGCAGCCTCGACCCCCAAGG + Intergenic
1092287986 12:7140829-7140851 CACTGAAGCCTCAAACCCCTCGG - Intronic
1092465767 12:8730159-8730181 CACTGCAGCCTCCAACCCCTAGG + Intronic
1093037404 12:14345804-14345826 CACTGTAGCCTCAAACCCCTAGG + Intergenic
1093300217 12:17443996-17444018 CACTGAAGCCTCTAACACCTGGG + Intergenic
1093470897 12:19501253-19501275 CACAGCAGCCTCCAACTCCTGGG - Intronic
1093716466 12:22388600-22388622 CACTGGAGCCTCTAAGTCCTGGG - Intronic
1094368582 12:29711056-29711078 CACTGCAGCCTCAAACTCCATGG + Intronic
1094552941 12:31470022-31470044 CACTGCAGCCTCTAACTCCTGGG + Intronic
1094577379 12:31699545-31699567 CGCAGGAGCCCCTGTCCCCATGG - Intronic
1094593244 12:31840795-31840817 CACAGCAGCCTCAAACTCCTGGG - Intergenic
1094648705 12:32352796-32352818 CACTGCAGCCTCTAACTCCCAGG - Intronic
1095445811 12:42280983-42281005 CACTGCAGCCTCGACCCCCAAGG - Intronic
1095903738 12:47355915-47355937 CACAGTAGCCACTAGCCACATGG - Intergenic
1096124910 12:49112103-49112125 CACTGTAGCCTCCAACTCCAAGG + Intergenic
1096133644 12:49181226-49181248 CACCGTAACCTCTAACTCCAGGG - Intergenic
1096265933 12:50122641-50122663 CACAGTAACCTCTAACTCCTAGG - Intergenic
1096373201 12:51085269-51085291 CACAGCAGCCTCAAACTCCCGGG + Intergenic
1096517813 12:52167239-52167261 CACTGCAGCCTCCAACCCCTGGG + Intergenic
1096557415 12:52411903-52411925 CACTGGAGCCTGTGGCCCCAGGG + Intergenic
1096589237 12:52646391-52646413 CACAGAAGCCACTCACCCTATGG + Intronic
1096751627 12:53762841-53762863 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1096831029 12:54314558-54314580 CACTGAAGCCTCTAACTCCCGGG + Intronic
1097172078 12:57121266-57121288 CACTGCAGCCTCTAACTCCTGGG + Intronic
1098130246 12:67342621-67342643 CACAGGACACTCTAATCCCTGGG + Intergenic
1098462717 12:70750803-70750825 CACTGTAGCCTCAAACCCCTGGG + Intronic
1098963917 12:76765774-76765796 CACTGCAGCCTCTACCTCCAGGG + Intronic
1099174179 12:79401743-79401765 CACTGTAGCCTCTAACTCCTGGG + Intronic
1099412796 12:82351654-82351676 CACAGCAGCCTCAAACTCCTGGG - Intronic
1099742834 12:86663282-86663304 CACTGCAGCCTGTAACTCCAGGG - Intronic
1099886709 12:88539847-88539869 CACTGGAGCCTCAAACTCCTGGG - Intronic
1100484599 12:95012858-95012880 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1100961462 12:99967492-99967514 CACAGCAGCCTCAAACTCCTGGG + Intronic
1101138195 12:101767696-101767718 CACAGCAGCCTCTAACTCCTAGG + Intronic
1101150104 12:101876656-101876678 CACTGCAGCCTCGACCCCCAAGG + Intergenic
1101492968 12:105227043-105227065 CACTGTAGCCTCTAACTCCACGG - Intronic
1101895801 12:108755688-108755710 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1101901368 12:108793468-108793490 CACAGCAGCCTCAAACTCCTGGG + Intronic
1101911530 12:108863667-108863689 CACAGCAGCCTCGACCTCCAGGG + Intronic
1101923489 12:108952308-108952330 CACCGCAACCTCTAACCCCCAGG + Intronic
1101951480 12:109179560-109179582 CACAGCAGCCTGTAACTCCTGGG + Intronic
1101956698 12:109218275-109218297 CACTGTAGCCTCTATCCCCTGGG + Intronic
1102045744 12:109829094-109829116 CACAGCAGCCTCGAACTCCTGGG - Intronic
1102230144 12:111256667-111256689 CCCAGGTGCCTCTCACTCCAGGG - Intronic
1102491856 12:113294158-113294180 CACTGTAGCCTCCAACCCCTGGG + Intronic
1102562475 12:113772164-113772186 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1102581735 12:113893105-113893127 CACAGCAGCCTCCAACTCCTGGG + Intronic
1102960916 12:117092718-117092740 CACTGCAGCCTCTAACTCCAAGG - Intronic
1103580240 12:121909387-121909409 CACTGCAGCCTCAAACTCCAGGG + Intronic
1103687479 12:122743534-122743556 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1103694628 12:122804791-122804813 CACTGCAGCCTCTAACTCCTGGG + Intronic
1103699795 12:122843119-122843141 CACAGGAGCCCCACTCCCCAAGG - Intronic
1103740460 12:123087692-123087714 CACTGGAGCCTCAAACTCCTGGG + Intronic
1103802200 12:123545732-123545754 CACAGCAGCCTCCAACTCCTGGG + Intergenic
1103934888 12:124470088-124470110 CACTGGAGCCTCTACCTCCTGGG - Intronic
1103976848 12:124708214-124708236 CACTGCAGCCTCTACCTCCAGGG + Intergenic
1103977424 12:124712446-124712468 CACAGCAGCCTCGAACTCCTGGG - Intergenic
1104422739 12:128650651-128650673 CACTGCAGCCTGTAACCCCTAGG - Intronic
1104454749 12:128901821-128901843 CACTGGAGCCTCGAACACCTAGG + Intronic
1104559821 12:129833547-129833569 CACAGCAGCCTCGAACTCCTGGG - Intronic
1104684678 12:130777137-130777159 CACTGCAGCCTCGAACTCCAAGG + Intergenic
1104700840 12:130903090-130903112 CACTGCAGCCTCTACCTCCAGGG + Intergenic
1104978426 12:132562265-132562287 GACAGGAACCTCTCACCCCTGGG - Intronic
1105044601 12:132991719-132991741 CACAGCAGCCTCGAACTCCTGGG - Intronic
1105396839 13:20044100-20044122 CATAGGAGACTTTAACCCTAGGG - Intronic
1105719106 13:23096208-23096230 CACAGCAGCCTCCAACTCCTGGG - Intergenic
1105832585 13:24177533-24177555 CACTGGAGCCTCAAACTCCTGGG + Intronic
1106198726 13:27517388-27517410 CACTGTAGCCTCAAACCCCTAGG - Intergenic
1106722519 13:32450704-32450726 CACTGCAGCCTCTACCTCCAGGG + Intronic
1107003803 13:35584392-35584414 CACAGCAGCCTTGAACCCCTGGG + Intronic
1107519628 13:41167020-41167042 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1107535939 13:41332131-41332153 CACTGTAGCCTCAAACCCCTGGG + Intronic
1107671643 13:42752515-42752537 CACAGCAGCCTCGAACTCCTGGG - Intergenic
1107672250 13:42758126-42758148 CATAGCAGCCTCTAACTCCTGGG + Intergenic
1107755407 13:43616276-43616298 CACTGGAACCTCTAACTCCTGGG + Intronic
1108010661 13:46005563-46005585 CACTGCAGCCTCGACCCCCAGGG + Intronic
1108416707 13:50205039-50205061 CACAGCAGCCTCAAACTCCTGGG + Intronic
1108457870 13:50634636-50634658 ACCAGGAGCCCCCAACCCCAGGG - Intronic
1108763784 13:53601993-53602015 CACTGCAGCCTCTACCACCAAGG - Intergenic
1109173014 13:59119013-59119035 CACTGTAGCCTCTAACTCCTGGG - Intergenic
1109259390 13:60125287-60125309 CACTGTAGCCTCAAACTCCAGGG + Intronic
1109634124 13:65091192-65091214 CACAGCAGCCTCGAACTCCTGGG + Intergenic
1109770399 13:66963263-66963285 TATAGGAGTCTCCAACCCCAAGG - Intronic
1110849712 13:80231363-80231385 CACAGCAGCCTCCAACTCCTAGG - Intergenic
1111112070 13:83725539-83725561 CACTGCATCCTCTAACCCCTGGG - Intergenic
1111117845 13:83804141-83804163 CACTGGAGCCTCTGACCCCAGGG - Intergenic
1111353433 13:87063993-87064015 CATTGGAGCCTCTAACTCCTGGG + Intergenic
1111569980 13:90071796-90071818 CACAGTAGCCTCTAACTTCTGGG + Intergenic
1111955425 13:94751938-94751960 CACTGCAGCCTCGAACCCCTGGG - Intergenic
1112030423 13:95451504-95451526 CACAGCAGCCTCCAACTCCTGGG + Intronic
1112030891 13:95455099-95455121 CACTGCAGCCTCTAACCCCTGGG - Intronic
1112457864 13:99578013-99578035 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1112527646 13:100167472-100167494 CACTGCAGCCTCAAACTCCAAGG - Intronic
1113485171 13:110647620-110647642 TAGAGGTGCCTCTGACCCCAGGG - Intronic
1113791854 13:113033264-113033286 CACAGGGGCCACTCACGCCACGG - Intronic
1113791863 13:113033300-113033322 CACAGGGGCCACTCACGCCACGG - Intronic
1113792194 13:113034823-113034845 CACAGCAGCCCCTAACCTCCGGG - Intronic
1113936218 13:113996376-113996398 CCCAGGAGCCTCCCACCCGAGGG - Intronic
1114238566 14:20844560-20844582 CACTGCAGCCTCTAACTCCAGGG - Intergenic
1114501287 14:23170799-23170821 CACTGCAGCCTCAAACCCCTGGG + Intronic
1114503208 14:23187422-23187444 CACAGCAGCCTCAAACTCCTGGG + Intronic
1114540955 14:23457883-23457905 CACAGGAGCTTCTGTCCCCATGG - Intergenic
1114754667 14:25245882-25245904 CACTGGAGCCTCAAACATCAGGG + Intergenic
1115250592 14:31342310-31342332 CACAGTAGCCTCGAACTCCTGGG - Intronic
1115693104 14:35866627-35866649 CACTGGAGCCTCGACCTCCAGGG - Intronic
1115812905 14:37130186-37130208 CACTGCAGCCTCTAACTCCTGGG - Intronic
1116596674 14:46857728-46857750 CACAGCAGCCTCAAACTCCTGGG + Intronic
1116824553 14:49659654-49659676 CACAGCAGCCTTTAACTCCTGGG + Intronic
1116907112 14:50414980-50415002 CACTGCAGCCTCTAACTCCCAGG + Intronic
1116923007 14:50601030-50601052 CACTGCAGCCTCAAACGCCAGGG - Intronic
1117247861 14:53903740-53903762 CACTGCAGCCTCAACCCCCATGG + Intergenic
1117302862 14:54445562-54445584 CACTGCAGCCTCCAACCCCATGG - Intergenic
1117307375 14:54489627-54489649 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1117554687 14:56872112-56872134 AACTGCAGCCTCCAACCCCAGGG + Intergenic
1117984967 14:61378286-61378308 CACTGCAGCCTCCAACTCCAGGG + Intronic
1118216152 14:63810146-63810168 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1118343817 14:64918755-64918777 CACTGGAGCCTCGAACTCCTGGG - Intronic
1118516709 14:66537901-66537923 CACTGCAGCCTCTAACTCCTAGG + Intronic
1118586486 14:67358622-67358644 CACAGCAGCCTCAAACCCCTGGG - Intronic
1118591813 14:67407514-67407536 CACTGCAGCCTCAAACCCCTGGG + Intronic
1118801008 14:69189950-69189972 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1119161441 14:72456026-72456048 CACAGAAGCTTCTCACGCCAGGG - Intronic
1119207820 14:72807887-72807909 CACTGCAGCCTCCAACTCCAGGG - Intronic
1119250209 14:73146029-73146051 CACTGGAACCTCTAACTCCTGGG - Intronic
1119363694 14:74073177-74073199 CACTGCAGCCTCAACCCCCAGGG + Intronic
1119419262 14:74497539-74497561 CACAGGAGTCTCGAACTCCTGGG + Intergenic
1119461190 14:74805417-74805439 CACTGGAGCCTCAAACTCCTGGG + Intronic
1119604871 14:76006931-76006953 CACTGGAGCCTCTATCTCCTAGG + Intronic
1119783608 14:77296186-77296208 CACAGGCACCTCTACCCCGAGGG - Exonic
1119863371 14:77953350-77953372 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1120724744 14:87925569-87925591 CACTGCAGCCTCGAACCCCTAGG - Intronic
1120794002 14:88611199-88611221 CACTGCAGCCTCAAACCCCTGGG + Intronic
1121024227 14:90602623-90602645 CACTGAAGCCTGGAACCCCAGGG - Intronic
1121063685 14:90940676-90940698 CACATGGGCCCCTAACCCCCAGG + Intronic
1121182995 14:91943431-91943453 CACTGCAGCCTCAAACCCCCTGG - Intronic
1121248020 14:92477533-92477555 CACTGCAGCCTCTAACTCCTAGG + Intronic
1121278475 14:92683694-92683716 CACTGGAGCCTCCAACTCCTGGG - Intronic
1121425181 14:93845675-93845697 CACAGCAGCCTCAAACTCCCGGG + Intergenic
1121964220 14:98289402-98289424 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1121999643 14:98636216-98636238 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1122192493 14:100057148-100057170 CACAGGAGCCTGAACCACCAGGG + Intronic
1122282423 14:100631335-100631357 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1122459983 14:101886803-101886825 CACTGCAGCCTCAAACCCCTGGG + Intronic
1122571451 14:102705518-102705540 CACTGCAGCCTCAAACCCCTGGG + Intronic
1123914778 15:25012873-25012895 CACTGTAGCCTCTGACACCAGGG + Intergenic
1124701416 15:31916172-31916194 CACAGCAGCCTCTATCTCCCGGG - Intergenic
1124701711 15:31919425-31919447 CACAGGAGCCTCCAATCCCTGGG + Intergenic
1125571639 15:40724576-40724598 CACTGCAGCTTCTAACTCCAGGG + Intronic
1125696073 15:41638439-41638461 CACTGCAGCCTCTAACTCCTGGG + Intronic
1125836584 15:42757180-42757202 CACTGCAGCCTCTAACTCCTGGG + Intronic
1125840275 15:42793989-42794011 CACTGCAGCCTCTAACTCCTGGG + Intronic
1126136526 15:45397530-45397552 TACAGGAGCTTCTGTCCCCATGG - Intronic
1126799188 15:52284913-52284935 CACTGGAGCCTCGAACTCCTGGG + Intronic
1127390430 15:58500899-58500921 CACAGGAACCCCTACCCCCTTGG + Intronic
1127491871 15:59472624-59472646 CACTGTAGCCTCTAACTCCTGGG + Intronic
1128324170 15:66712929-66712951 CACTGCAGCCTCTAACTCCTGGG - Intronic
1128461186 15:67868943-67868965 CACAGGAGCTTCTGTCCCCATGG - Intergenic
1128627234 15:69222256-69222278 CACAGGAGCACTTAAGCCCATGG - Intronic
1128709189 15:69859023-69859045 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1128749257 15:70137202-70137224 CACAGCAGCCTCTATCTCCCAGG + Intergenic
1128862366 15:71084558-71084580 CACTGCAGCCTCGAACTCCAAGG + Intergenic
1129325201 15:74796516-74796538 CACAGCAGCCTCAAACCCCTGGG - Intronic
1129349590 15:74947518-74947540 CACTGCAGCCTTTAACCCCTGGG + Intergenic
1129354832 15:74983052-74983074 CACTGGAGCCTCGAACTCCCAGG - Intronic
1129409592 15:75341990-75342012 CACTGCAGCCTCAAACCCCTGGG - Intronic
1129575161 15:76735295-76735317 CACTGCAGCCTCTAACTCCTGGG - Intronic
1129763269 15:78144446-78144468 CACTGTAGCCTCTAACTCCTGGG + Intronic
1129768287 15:78184247-78184269 CACTGCAGCCTCAAACCCCTGGG + Intronic
1130172757 15:81533063-81533085 CACTGTAGCCTCCACCCCCAGGG + Intergenic
1130353554 15:83110944-83110966 CACTGCAGCCTCCAACCCCCAGG + Intronic
1131239207 15:90724086-90724108 CACTGCAGCCTCTAACTCCTGGG + Intronic
1131327389 15:91461202-91461224 CACTGGAGCCTCAAACTCCTGGG + Intergenic
1131691047 15:94827849-94827871 CACTGCAGCCTCGAACCCCTGGG + Intergenic
1132469718 16:95643-95665 CACTGCAGCCTCGAACACCAGGG + Intronic
1132661753 16:1064655-1064677 CACTGGAGCCTCTAATGCCTGGG - Intergenic
1133091756 16:3410083-3410105 CACTGCAGCCTCTAACTCCTGGG - Intronic
1133174472 16:4003638-4003660 CACTGCAGCCTCTAACTCCTGGG + Intronic
1133200836 16:4203595-4203617 CACTGCAGCCTCTAACTCCTGGG + Intronic
1133204227 16:4223451-4223473 CACTGCAGCCTCAAACTCCAGGG + Intronic
1133617489 16:7491704-7491726 CACAGCAGCCTCAAACTCCTGGG + Intronic
1133877227 16:9746362-9746384 CACTGAAGCCTCGAACCCCTGGG - Intergenic
1133877645 16:9750065-9750087 CACTGCAGCCTCGAACCCCCAGG - Intergenic
1133934068 16:10254836-10254858 CACTGCAGCCTCGAACCCCTGGG + Intergenic
1133976909 16:10605760-10605782 CACTGCAGCCTCAAACCCCCGGG + Intergenic
1133998399 16:10764103-10764125 CACAGGAGTATCTCAGCCCACGG + Intronic
1133998409 16:10764157-10764179 CACAGGAGTATCTCAGCCCACGG + Intronic
1133998421 16:10764211-10764233 CACTGGAGCATCTCAGCCCATGG + Intronic
1134060782 16:11198372-11198394 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1134103002 16:11465695-11465717 CACTGCAGCCTCAAACCCCTGGG - Intronic
1134115090 16:11542143-11542165 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1134129736 16:11641131-11641153 CACAGGAGCCTCGACCTCCTGGG - Intergenic
1134174128 16:11992216-11992238 CACTGCAGCCTCCAACTCCAGGG - Intronic
1134433572 16:14234717-14234739 CACTGCAGCCTCAAACTCCAGGG - Intronic
1134438297 16:14281795-14281817 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1134439479 16:14289714-14289736 CACTGGAGCCTCAAACTCCTGGG + Intergenic
1134506327 16:14810478-14810500 CACTGCAGCCTCTAACTCCCTGG - Intronic
1134527747 16:14957534-14957556 CACTGCAGCCTCAAACCCCGAGG + Intergenic
1134574225 16:15318285-15318307 CACTGCAGCCTCTAACTCCCTGG + Intergenic
1134619620 16:15677657-15677679 CACTGCAGCCTCTAACTCCTGGG + Intronic
1134726203 16:16420309-16420331 CACTGCAGCCTCGAACCCCTAGG - Intergenic
1134939244 16:18273814-18273836 CACTGCAGCCTCTAACTCCCTGG + Intergenic
1134941231 16:18291551-18291573 CACTGCAGCCTCGAACCCCTAGG + Intergenic
1135037060 16:19087095-19087117 CACTGCAGCCTCTAACTCCTAGG + Intergenic
1135079639 16:19423046-19423068 CACTGGAGCCTCTAACTGCTGGG - Intronic
1135099250 16:19592148-19592170 CACTGCAGCCTCAAACCCCTGGG + Intronic
1135104418 16:19635270-19635292 CACTGCAGCCTCTAACTCCTGGG - Intronic
1135362110 16:21823902-21823924 CACAGCAGCCTCCAACTCCTGGG - Intergenic
1135380469 16:21992151-21992173 CACTGCAGCCTCGAACCCCTGGG - Intronic
1135410706 16:22232300-22232322 CACTGCAGCCTCTAACTCCTGGG + Intronic
1135417434 16:22279311-22279333 CACTGCAGCCTCTAACTCCTGGG + Intronic
1135477833 16:22793169-22793191 CACTGCAACCTCTACCCCCAGGG - Intergenic
1135541035 16:23330646-23330668 CACTGCAGCCTCCAACCCCTGGG + Intronic
1135641356 16:24122533-24122555 CACAGCAGCCTCTAACTCCTGGG + Intronic
1135678210 16:24435241-24435263 CACTGTAGCCTCTAACTCCTGGG - Intergenic
1135707785 16:24689824-24689846 CACTGAAGCCTCGAACCCCTGGG + Intergenic
1135803622 16:25522216-25522238 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1135814023 16:25615691-25615713 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1135845093 16:25911580-25911602 CACTGCAGCCTCCAACCCCTGGG + Intronic
1135945782 16:26863738-26863760 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1136032945 16:27516708-27516730 CACTGCAGCCTCGAACTCCAGGG + Intronic
1136119178 16:28119089-28119111 CACAGCAGCCTCCAACTCCTGGG + Intronic
1136126548 16:28186745-28186767 CACTGCAGCCTCAAACCCCTGGG + Intronic
1136242850 16:28955116-28955138 CACTGCAGCCTCTAACTCCTGGG - Intronic
1136491497 16:30611251-30611273 CACTGCAGCCTCTAACTCCTGGG + Intronic
1136525407 16:30826430-30826452 CACTGGAGCCTCAAACTCCTGGG + Intergenic
1136587931 16:31199782-31199804 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1137263976 16:46853620-46853642 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1137284903 16:47007400-47007422 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1137323441 16:47410201-47410223 CACAGGAGCCTCAACCTCCTGGG - Intronic
1137331243 16:47498824-47498846 CACTGCAGCCTCTAACCCCTGGG - Intronic
1137623846 16:49895156-49895178 CACTGGAGCCTTGAACCCCTGGG - Intergenic
1137981316 16:53072475-53072497 CACTGTAGCCTCTAACTCCTGGG + Intronic
1138063306 16:53913901-53913923 CACAGCAGCCTCCGCCCCCAGGG - Intronic
1138114282 16:54348184-54348206 CACTGCAGCCTCTACCTCCAGGG + Intergenic
1138167499 16:54816918-54816940 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1138213276 16:55180790-55180812 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1138332744 16:56228064-56228086 GACAGGAAGCTCTCACCCCACGG + Intronic
1138465866 16:57189665-57189687 CACAGAAGCCTCTACCTCCCAGG + Intronic
1138684991 16:58717299-58717321 CACAGCAGCCTCTACCTCCAGGG - Intronic
1138695041 16:58805058-58805080 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1138952483 16:61929812-61929834 CACTGCAGCCTCTAACTCCTGGG - Intronic
1138954910 16:61959456-61959478 CACAGGTGTCTGTTACCCCAAGG - Intronic
1138991790 16:62398982-62399004 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1139077117 16:63464822-63464844 CACAGGAGCTTCTAACTTTAAGG - Intergenic
1139289466 16:65844396-65844418 CACTGTAGCCTCTAACTCCTGGG - Intergenic
1139438860 16:66953813-66953835 CCCAGGAGCCTCTCCACCCAGGG + Intergenic
1139763390 16:69206070-69206092 CACAGCATCCTCTAACTCCTGGG + Intronic
1139919173 16:70448263-70448285 CACAGCAGCCTCCAACCCCTGGG - Intergenic
1140031959 16:71346041-71346063 CACTGCAGCCTCGAACCCCTGGG + Intergenic
1140180957 16:72718086-72718108 CACAGTAGCCTCAAACTCCTGGG - Intergenic
1140415323 16:74770182-74770204 GACAGGGGGCTCTAACCACAAGG + Intronic
1140535180 16:75703387-75703409 CACTGGAGCCTCAAACTCCAGGG + Intronic
1140827710 16:78722964-78722986 CACTGCAGCCTCTAACTCCTGGG - Intronic
1141519440 16:84568071-84568093 CACAGCAACCTCTGCCCCCAGGG + Intronic
1141539475 16:84708373-84708395 CACAGCAACCTCTGCCCCCACGG - Intronic
1141655663 16:85415018-85415040 CACAGCAGCCTCTACCTCCTGGG + Intergenic
1141691586 16:85599822-85599844 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1141747814 16:85937832-85937854 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1142469088 17:152694-152716 CACAGCAGCCTCAAACTCCTGGG - Intronic
1142700153 17:1654705-1654727 CACTGCAGCCTCAAACCCCCGGG + Intronic
1142798297 17:2326701-2326723 CACTGGAGCCTCAAACTCCTGGG + Intronic
1142840589 17:2625860-2625882 CACTGCAGCCTCTAACTCCTAGG - Intronic
1142922588 17:3202512-3202534 CACTGTAGCCTCAAACTCCAGGG - Intergenic
1143076127 17:4344783-4344805 CACTGCAGCCTCAAACCCCTGGG - Intronic
1143279286 17:5739295-5739317 CACTGGAGCCTCAAACTCCTGGG - Intergenic
1144211595 17:13020138-13020160 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1144392096 17:14803283-14803305 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1144706172 17:17369737-17369759 CACTGCAGCCTCTAACCCCTGGG - Intergenic
1145042063 17:19584379-19584401 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1145076091 17:19855937-19855959 CACTGCAGCCTCTAACTCCTGGG - Intronic
1145260350 17:21351126-21351148 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1145316267 17:21736814-21736836 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1146099215 17:29963015-29963037 CACTGAAGCCTCAAACTCCAGGG + Intronic
1146196259 17:30815617-30815639 CACTGCAACCTCTAACCCCCAGG + Intronic
1146283075 17:31557967-31557989 CACTGTAGCCTCTAACTCCTGGG + Intergenic
1146322884 17:31860063-31860085 CACAGGAGTCAGTATCCCCAAGG + Intergenic
1146749113 17:35361535-35361557 CACTGCAGCCTCAAACTCCAGGG + Intronic
1146940077 17:36838362-36838384 CACTGGAGCCTCAAACTCCTGGG + Intergenic
1147010645 17:37444181-37444203 CACTGCAGCCTCGAACCCCCAGG - Intronic
1147643435 17:42019195-42019217 CACTGCAGCCTCTAACTCCTGGG - Intronic
1147681280 17:42248197-42248219 CACAGCAGCCTCAAACTCCTGGG - Intronic
1147719327 17:42528970-42528992 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1147719677 17:42531326-42531348 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1147863874 17:43540615-43540637 CACTGCAGCCTCTAACTCCTGGG + Intronic
1148017960 17:44535870-44535892 CACAGTAGCCTCAAACTCCTGGG + Intergenic
1148077088 17:44943781-44943803 CACAGCAGCCTCGAACTCCTGGG + Intronic
1148341533 17:46876280-46876302 CACAGGAGCCTGATACGCCATGG - Exonic
1148503091 17:48106868-48106890 CACTGCAGCCTCGAACCCCTGGG + Intronic
1148572652 17:48682732-48682754 CACTGCAGCCTCTATCTCCAGGG - Intergenic
1148609238 17:48953050-48953072 CACAGCAGCCTCAAACTCCTGGG - Intergenic
1148816964 17:50335321-50335343 CACAGCAGCCTCAAACCCTTGGG + Intergenic
1148901699 17:50883510-50883532 CACTGAAGCCTCAAACCCCTGGG - Intergenic
1149360381 17:55889036-55889058 CACAGGAGTCCCCAACCCCCAGG + Intergenic
1149371527 17:55997971-55997993 CACTGCAGCCTCCAACCCCTGGG - Intergenic
1149792519 17:59491636-59491658 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1150021282 17:61615931-61615953 CACAGGAGCCTCTATCTCTGTGG - Intergenic
1150211406 17:63443701-63443723 CACAGCAGCCTCGAACTCCTGGG + Intronic
1150334654 17:64321683-64321705 CACCGCAGCCTCGAACCCCTGGG - Exonic
1150372852 17:64655817-64655839 CACTGGAGCCTCTGACCCCTGGG - Intronic
1150580103 17:66465465-66465487 CACAGCAGCCTCAAACTCCTGGG + Intronic
1150646884 17:66984303-66984325 CACTGCAGCCTCAAACTCCAGGG - Intronic
1150779427 17:68108727-68108749 CACTGCAGCCTCTAACCCCTGGG + Intergenic
1150808093 17:68335070-68335092 CACTGCAGCCTCTAACTCCTGGG + Intronic
1151382223 17:73733810-73733832 CACAGGAACCTCCAAACCAAGGG + Intergenic
1151577709 17:74961064-74961086 CACAGCAGCCTCAAGCCACAAGG + Intronic
1151664691 17:75538966-75538988 CACAGCAGCCTCAAACTCCTGGG + Intronic
1151695072 17:75710774-75710796 CACAGCAGCCTCCAACTCCTGGG - Intergenic
1152024331 17:77798924-77798946 AACAGGAGACTCCAACTCCAAGG + Intergenic
1152713482 17:81886736-81886758 CACAGCAGCCTCAACCTCCAGGG + Intergenic
1152791150 17:82280734-82280756 CACTGAAGCCTCAAACTCCAGGG - Intergenic
1152827179 17:82474103-82474125 CACTGCAGCCTCTAACTCCTTGG - Intronic
1152970989 18:160445-160467 CACAGCACCCTCTAACTCCTTGG - Intronic
1153246619 18:3078503-3078525 CACAGCAGCCTCAACCTCCAGGG + Intronic
1153365369 18:4249661-4249683 CACTGTAGCCTCTATCTCCACGG + Intronic
1153594634 18:6712517-6712539 CACTGGAGCCTCAAACTCCTGGG + Intergenic
1153768645 18:8398046-8398068 CACTGCAGCCTCAAACCCCTGGG + Intronic
1153779512 18:8482137-8482159 CACTGGAGCCTCGAACTCCTCGG - Intergenic
1153893562 18:9539745-9539767 CGCAGGAACCTCTGAGCCCAGGG - Intergenic
1154142269 18:11834640-11834662 CACTGTAGCCTCAAACTCCAAGG - Intronic
1154163652 18:11998089-11998111 CACAGTAACCTCTAACCCCAGGG - Intronic
1154211047 18:12378344-12378366 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1154327104 18:13399119-13399141 CACTGCAGCCTCAAACTCCAAGG - Intronic
1155132464 18:22951899-22951921 CACAGGAGCTTCTGTCACCATGG + Intronic
1155296038 18:24385313-24385335 CACAGCAGCCTCGAACTCCTGGG - Intronic
1155615419 18:27716214-27716236 CACTGCAGCCTCAAACTCCAAGG + Intergenic
1155931676 18:31715299-31715321 CACTGGAGCCTCAAACTCCTGGG + Intergenic
1155934101 18:31737635-31737657 CACTGCAGCCTCAAACACCAGGG + Intergenic
1156030773 18:32709521-32709543 CACAGCAGCCTCCAACTCCTGGG + Intronic
1156069949 18:33195039-33195061 CACTGCAGCCTCAAACTCCAGGG - Intronic
1156088921 18:33441384-33441406 CACTGCAGCCTCTAACCACTGGG - Intergenic
1156205694 18:34883385-34883407 CACTGCAGCCTCTAACTCCTGGG + Intronic
1156225267 18:35099537-35099559 CACTGCAGCCTCTAACTCCTAGG - Intronic
1156273013 18:35554717-35554739 CACAGCAGCTTCTGTCCCCATGG + Intergenic
1156286186 18:35698391-35698413 CACTGCAACCTCTACCCCCAAGG - Intronic
1156440888 18:37186489-37186511 CACTGCAGCCTCTAACTCCTGGG - Intronic
1156706371 18:39887891-39887913 AACAGGAGCCCCCAACCCCTAGG - Intergenic
1156835235 18:41545674-41545696 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1156875551 18:42006246-42006268 CACAGGAGCTTCTGTCCCCATGG + Intronic
1156904792 18:42339951-42339973 CACTGCAGCCTCGAACCCCCAGG + Intergenic
1157018809 18:43753965-43753987 CACAGTAGCCTCTATCTCCCAGG + Intergenic
1157441309 18:47713886-47713908 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1157573668 18:48730189-48730211 CACAGGAGCCCCTCACACCTCGG - Intronic
1157715619 18:49884723-49884745 CACAGGAGTCCCCAACCCCTAGG - Intronic
1157792936 18:50549118-50549140 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1157807371 18:50668204-50668226 CACAGAAGCATCTGTCCCCAGGG + Intronic
1157832432 18:50869013-50869035 CACTGGAGCCTCGAACCCCTGGG - Intergenic
1158603764 18:58876982-58877004 CACTGCAGCCTCTAACTCCTGGG - Intronic
1158961222 18:62588982-62589004 CACAGAAGCCTCGAACTCCTGGG - Intergenic
1159052914 18:63438179-63438201 CACTGCAGCCTCAAACCCCTAGG - Intergenic
1159312346 18:66725672-66725694 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1159770827 18:72543753-72543775 CCCAGGTGCCTCCAACCCCTGGG + Intronic
1159915901 18:74187485-74187507 CACTGTAGCCTCTAACTCCTGGG - Intergenic
1160303881 18:77713128-77713150 CACTGGAACCTCAACCCCCAAGG - Intergenic
1160509745 18:79446790-79446812 CACAGGAGTCTCTGCACCCAAGG - Intronic
1160933447 19:1581667-1581689 CACAGCAGCCTCTACCTCCCGGG - Intronic
1160949511 19:1658707-1658729 CACAGGTGCCCCCAACCCCAAGG + Intergenic
1161084344 19:2327611-2327633 CACTGCAGCCTCAAACCCTAGGG + Intronic
1161189675 19:2946188-2946210 CACTGCAGCCTCAATCCCCACGG - Intergenic
1161295813 19:3519738-3519760 CCCAGGAGCCCCTGCCCCCAGGG + Intronic
1161359558 19:3839927-3839949 CACTGCAGCCTCTAACTCCTGGG + Intronic
1161361769 19:3854006-3854028 CACTGCAGCCTCAAACTCCAGGG - Intronic
1161361867 19:3854837-3854859 CACTGCAGCCTCTAACTCCTGGG + Intronic
1161542770 19:4862012-4862034 CACTGCAGCCTCTAACTCCTGGG + Intronic
1161712778 19:5859098-5859120 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1161731456 19:5963473-5963495 CACTGCAGCCTCTAACTCCTGGG - Intronic
1161748939 19:6080115-6080137 CACTGTAGCCTCTAACTCCAGGG + Intronic
1161829526 19:6592278-6592300 CACAGCAGCCTCAAACTCCTGGG + Intronic
1161910722 19:7191751-7191773 CACTGCAGCCTCAAACCCCTGGG - Intronic
1161969172 19:7566880-7566902 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1162025548 19:7891973-7891995 CACTGCAGCCTCTAACTCCTGGG + Intronic
1162198779 19:9006481-9006503 CACAGCAGCCTCTGCCTCCAGGG + Intergenic
1162291944 19:9786569-9786591 CACTGCAGCCTCCAACCCCTGGG + Intronic
1162339668 19:10085014-10085036 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1162363560 19:10233862-10233884 CACTGGAACCTCTACCTCCAGGG - Intergenic
1162368182 19:10262187-10262209 CACTGCAGCCTCTACCCCTAGGG - Intergenic
1162390578 19:10387413-10387435 CACTGCAGCCTCTAACCTCTGGG - Intergenic
1162472017 19:10877915-10877937 CACTGCAGCCTCTAACTCCTGGG + Intronic
1162580623 19:11527916-11527938 CACTGCAGCCTCAAACTCCATGG - Intronic
1162715082 19:12625918-12625940 CACTGCAACCTCTAACCCCTGGG + Intronic
1162763406 19:12902557-12902579 CACTGGAGCCTCAAACTCCTGGG - Intronic
1162888343 19:13713332-13713354 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1162891582 19:13737101-13737123 CACTGCAGCCTCAAACTCCAGGG + Intronic
1163002886 19:14379958-14379980 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1163122213 19:15224744-15224766 CACAGCAGCCTCTACCTCCTGGG - Intergenic
1163240981 19:16063744-16063766 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1163257144 19:16163184-16163206 CACTGCAGCCTCTAACTCCTCGG - Intronic
1163280792 19:16315972-16315994 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1163323383 19:16587505-16587527 CATGGGAGCCTCAAACCCCAGGG + Intronic
1163424555 19:17234339-17234361 CACTGGAGCCTCGAACTCCTGGG + Intronic
1163471000 19:17496945-17496967 CACTGCAGCCTCTAACTCCTGGG - Intronic
1163477553 19:17535368-17535390 CACAGCAGCCCCTAACTCCTGGG - Intronic
1163520144 19:17787333-17787355 CACTGCAGCCTCTAACTCCTGGG - Intronic
1163522340 19:17798892-17798914 CACTGCAGCCTCCAACTCCAGGG - Intronic
1163578937 19:18126691-18126713 CACTGCAGCCTCAAACCCCTGGG - Intronic
1163832935 19:19555835-19555857 CACTGCAGCCTCGAACTCCAGGG - Intergenic
1164189167 19:22899558-22899580 CACAGGAACCTCCACCCACAAGG + Intergenic
1164524925 19:29006681-29006703 CACAGTAGCCTCTAACTCCTGGG + Intergenic
1164612543 19:29642633-29642655 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1164641772 19:29831539-29831561 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1164668104 19:30055652-30055674 CACTGCAGCCTCGAACCCCTGGG + Intergenic
1164681119 19:30134426-30134448 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1164826535 19:31288616-31288638 CACTGCAGCCTCTAACTCCTGGG + Intronic
1164943428 19:32269424-32269446 CACTGTAGCCTCAAACTCCAGGG + Intergenic
1165006683 19:32813098-32813120 CACTGCAGCCTCGAACTCCAGGG - Intronic
1165052648 19:33151802-33151824 CACAGCAGCCTCAAACTCCTAGG - Intronic
1165056777 19:33182245-33182267 CACTGCGGCCTCTAACTCCAGGG + Intronic
1165436749 19:35799670-35799692 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1165564032 19:36707969-36707991 CACTGCAGCCTCTAACTCCTGGG + Intronic
1165579616 19:36850799-36850821 CCCAGAAGCCTCTAGGCCCAGGG + Intronic
1165696047 19:37901787-37901809 CACTGCAGCCTCAAACCCCTGGG + Intronic
1165766248 19:38352950-38352972 CACTGCAGCCTCAAACCCCTGGG - Intronic
1165926831 19:39331697-39331719 CACTGTAGCCTCTAACTCCTGGG - Intronic
1165984899 19:39759425-39759447 CACTGAAGCCTCGAACCCCAGGG + Intergenic
1166067319 19:40367503-40367525 CACTGCAGCCTCGAACCCCTGGG - Intronic
1166188707 19:41160677-41160699 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1166205974 19:41269402-41269424 CACAGCAGCCTCAAACTCCTGGG - Intronic
1166358964 19:42244142-42244164 CACTGCAGCCTCTAACTCCCAGG + Intronic
1166547244 19:43640616-43640638 CACAGGAGCCTCTCCCTCCTGGG - Intergenic
1166552230 19:43673650-43673672 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1166647085 19:44540226-44540248 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1166660374 19:44643402-44643424 CACTGAAGCCTCTAACTCCTGGG + Intergenic
1167028838 19:46943114-46943136 CACGGCAGCCTCTAACTCCTAGG + Intronic
1167044899 19:47043988-47044010 CACTGCAGCCTCTAACTCCCGGG - Intronic
1167326346 19:48828540-48828562 CACAGCAGCCTCGAACCCCTGGG - Intronic
1167342581 19:48924576-48924598 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1167484491 19:49753675-49753697 CACTGCAGCCTCTAACTCCCAGG - Intronic
1167658579 19:50782358-50782380 CACAGCAGCCTCTACCTCCTGGG - Intergenic
1167783489 19:51616150-51616172 CAGAGTAGCCAATAACCCCAGGG + Intronic
1167817684 19:51898499-51898521 CACAGGAGCCTCTGATCCCATGG + Intronic
1168298918 19:55392305-55392327 CACTGCAGCCTCTAACTCCTGGG + Intronic
1168544474 19:57239391-57239413 CACTGCAGCCTCAAACTCCAGGG - Intergenic
925939705 2:8805148-8805170 CACAGGAGCTTCTGTCCCCATGG + Intronic
926022909 2:9512916-9512938 TACAGGAGCTTCTGTCCCCATGG - Intronic
926158009 2:10468633-10468655 TACAGCAGCCTCTAACTCCTGGG + Intergenic
926814010 2:16782420-16782442 CCCAGGAGCCTCTAGGCCCTTGG + Intergenic
926963050 2:18379945-18379967 ATCAGGAGCCTCTAACCCCCAGG + Intergenic
927775531 2:25900001-25900023 CACAGCAACCTCTAACTCCAGGG + Intergenic
927797704 2:26064980-26065002 CACTGCAGCCTCTAACTCCTGGG - Intronic
928025011 2:27732390-27732412 CACTGTAGCCTCAAACCCCTGGG + Intergenic
928658894 2:33480770-33480792 CACAGGAGCTGTTAACTCCAGGG - Intronic
928950605 2:36809913-36809935 CACTGCAGCCTCCAACTCCAGGG - Intronic
929110202 2:38399856-38399878 CACTGCAGCCTCTAACTCCCAGG - Intergenic
929458013 2:42079817-42079839 CACTGCAGCCTCTAACTCCCAGG - Intergenic
929525948 2:42703033-42703055 CACTGCAGCCTCTAACTCCTGGG + Intronic
929991937 2:46797672-46797694 CACTGCAGCCTCCACCCCCAGGG + Intergenic
930009234 2:46923064-46923086 CACAGGTGCTTCTGTCCCCATGG + Intronic
930018048 2:46984357-46984379 CAGAGTGGCCTCCAACCCCAGGG - Intronic
930060710 2:47286136-47286158 CACTGCAGCCTCAAACCCCTGGG - Intergenic
930116962 2:47726308-47726330 CACAGCAGCCTCAAACTCCTGGG + Intronic
930509207 2:52324056-52324078 CACTGTAGCCTCTAACTCCCAGG + Intergenic
930637850 2:53825425-53825447 CACTGCAGCCTCTAACTCCTGGG - Intergenic
930797920 2:55412366-55412388 AGCAGGAGTCTCTAACCCCTGGG + Intronic
930829347 2:55726454-55726476 CACTGCAGCCTCTAACTCCTGGG + Intergenic
931278235 2:60763577-60763599 CACAGCAGCCTCTACCTCCCAGG + Intronic
931301469 2:60982903-60982925 CACTGCAGCCTCTAACTCCCAGG + Intronic
931410488 2:62025452-62025474 CACTGCAGCCTCTAACTCCTGGG - Intronic
931420076 2:62118944-62118966 CACAGGACCCTCTAAGCACTGGG + Intronic
931506079 2:62928150-62928172 CCCAGCAACCTCTAACCACAGGG - Intronic
932163227 2:69481879-69481901 CACTGCAGCCTCAAACCCCCTGG + Intronic
932327592 2:70873311-70873333 CACTGGAGCCTCAAACTCCTAGG + Intergenic
932381301 2:71286217-71286239 CACTGCAGCCTCTAACTCCTGGG + Intronic
932584493 2:73018130-73018152 CACTGGAGCCTCAAACTCCTGGG - Intronic
932819069 2:74884345-74884367 CCCTGGGGTCTCTAACCCCAGGG - Intronic
932856081 2:75235279-75235301 CCCAGAAGCATCTAATCCCATGG + Intergenic
933314440 2:80699338-80699360 CACAGCAGGCTCAAACCCCAGGG + Intergenic
933736862 2:85502327-85502349 CACAGCAGCCTCGAACTCCTAGG - Intergenic
933778550 2:85786507-85786529 CAGAGGAGCCTGCCACCCCAGGG + Intronic
934096412 2:88610044-88610066 CACAGTAGCCTCCAACTCCTGGG - Intronic
934568233 2:95352424-95352446 GTCAGCAGCCTCTGACCCCAGGG - Intronic
935212201 2:100947620-100947642 AACAGGAGCCACTAGCCACATGG - Intronic
935279925 2:101508129-101508151 CACTGCAGCCTCTAACTCCTGGG + Intergenic
935790972 2:106589829-106589851 CACTGCAGCCTCTAACTCCTGGG + Intergenic
935819556 2:106881059-106881081 CACTGCAGCCTCAAACTCCAGGG + Intronic
935841659 2:107118939-107118961 CACAGCAGCCTCTATCTCCCTGG + Intergenic
936052801 2:109238122-109238144 CACTGCAGCCTCCAACTCCAAGG - Intronic
936598723 2:113874728-113874750 CACTGCAGCCTCTAACTCCTGGG - Intergenic
937163843 2:119793929-119793951 CACAGCAGCCTCGAACTCCTGGG + Intronic
937177687 2:119957384-119957406 AACAGGAGCCCCCAACCCCTGGG + Intronic
937227377 2:120377559-120377581 CCCAGCAGCCTCTGACCCCATGG + Intergenic
937373696 2:121320639-121320661 CACAGCAGCCTCTACCTCCCAGG + Intergenic
937776989 2:125789635-125789657 CACAGAAGCCTCTAAGTCCTGGG - Intergenic
937907636 2:127060035-127060057 CACAGGAGCCAGTTACCCCATGG - Intronic
938061322 2:128257041-128257063 CACTGCAGCCTCTACCTCCAGGG - Intronic
938311314 2:130290164-130290186 CACACCAGCCTCTAACTCCTAGG - Intergenic
938340535 2:130533139-130533161 CACTGCAGCCTCTACCTCCAGGG - Intergenic
938349295 2:130587580-130587602 CACTGCAGCCTCTACCTCCAGGG + Intergenic
939185392 2:138854834-138854856 CACTGCAGTCTCTAACCCCTGGG + Intergenic
939193708 2:138946457-138946479 CACTGGAGCCTCCAACTCCTGGG - Intergenic
939589497 2:144046459-144046481 CACTGCAGCCTCAAACCCCTGGG + Intronic
939735172 2:145835214-145835236 CACAAGAGCCTCAAACTCCCAGG + Intergenic
939774576 2:146368518-146368540 CACTGCAACCTCTAACTCCAGGG - Intergenic
939830804 2:147068626-147068648 CACTGCAGCCTCGAACTCCAGGG + Intergenic
939934959 2:148279856-148279878 CACTGCAGCCTCAAACTCCATGG + Intronic
940051929 2:149474270-149474292 CACTGGAGCCTCAAACTCCTGGG + Intergenic
940276464 2:151945573-151945595 CACTGGAGCCTCTACTTCCAGGG - Intronic
940289168 2:152061234-152061256 CACAGCAACCTCCAACCCCTGGG - Intronic
940528730 2:154851164-154851186 CACTGCAGCCTCAAACCCCTGGG - Intronic
941030981 2:160511361-160511383 CACTGCAGCCTCTACCTCCAGGG + Intergenic
941299885 2:163787985-163788007 CACAGGAGCTTCTGTGCCCAAGG + Intergenic
941963158 2:171273941-171273963 CACTGGAGCCTCAAACTCCTGGG + Intergenic
942740473 2:179170860-179170882 CGCAGGAGCTTCGAACCCTAGGG - Intronic
943425448 2:187726928-187726950 CACTGCAGCCTCAAACCCCTAGG + Intergenic
943585030 2:189728511-189728533 CACTGCAGCCTCAAACCCCTGGG + Intronic
943624928 2:190187776-190187798 CACAGCAGCCTCGAACTCCTGGG - Intronic
943747891 2:191481188-191481210 CACTGCAGCCTCTAACTCCTGGG + Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
944135902 2:196398902-196398924 CACTGCAGCCTCTAACTCCTGGG - Intronic
944616007 2:201461262-201461284 CACAGCAGCCTTTAACTCCTGGG + Intronic
944619870 2:201503468-201503490 CACTGTAGCCTCTAACTCCTGGG + Intronic
944691952 2:202166574-202166596 CACAGCAGCCTCAAACTCCTGGG - Intronic
944727750 2:202488532-202488554 CACAGCAGCCTCAAACTCCTGGG + Intronic
944738682 2:202590835-202590857 CACAGTAGCCTCAAACTCCTGGG + Intergenic
944998804 2:205325602-205325624 CACTGTAGCCTCAGACCCCAGGG + Intronic
945315404 2:208365812-208365834 CACTGCAGCCTCTAACTCCTGGG + Intronic
946023076 2:216655121-216655143 CACTGCAGCCTCTAACCCCTGGG + Intronic
946235218 2:218320490-218320512 CACTGCAGCCTCAAACTCCAGGG - Intronic
946272163 2:218603402-218603424 CACTGCAGCCTCTAACTCCTGGG + Intergenic
946473525 2:219985505-219985527 CACTGCAGCCTCTAACTCCTGGG + Intergenic
946706605 2:222464556-222464578 CACTGGAGCCTCTACCACCCAGG + Intronic
946728038 2:222681470-222681492 CACAGGAGTTTCTGTCCCCATGG + Intronic
947306192 2:228750061-228750083 CACTGTAGCCTCAAACCCCTGGG - Intergenic
947850019 2:233279100-233279122 CACAGCAGCCTCTCACTCCTGGG - Intronic
947972892 2:234338720-234338742 CACTGCAGCCTCAAACCCCTGGG - Intergenic
948163945 2:235846710-235846732 CACTGCAGCCTCTAACTCCTGGG + Intronic
948443446 2:238013192-238013214 CACTGCAGCCTCGAACTCCAGGG - Intronic
948930258 2:241127355-241127377 CACAGGTTCCTCTCTCCCCAAGG + Exonic
1168784114 20:522779-522801 CACAGCAGCCTCAAACTCCTGGG + Intronic
1168898518 20:1340523-1340545 CACTGCAGCCTCTAACTCCTGGG + Intronic
1168986071 20:2050162-2050184 CACTGCAACCTCTGACCCCAGGG + Intergenic
1168987810 20:2065296-2065318 CACTGCAGCCTCTAACTCCTAGG + Intergenic
1169184431 20:3602252-3602274 CACAGCAACCTCTACCTCCAAGG - Intronic
1169317428 20:4604322-4604344 CACAGGAGCCTCAAACTACTGGG + Intergenic
1169422108 20:5469156-5469178 CTCAGGAGCTCCAAACCCCAAGG + Intergenic
1169454459 20:5739987-5740009 CACTGGAACCTCTACCTCCAGGG + Intergenic
1169470533 20:5881445-5881467 CACAGCAGCCTCTATCTCCCAGG - Intergenic
1169661673 20:7985347-7985369 CACAGCAGCCTCGAACTCCTGGG + Intronic
1169872162 20:10259612-10259634 CACTGCAGCCTCTAACTCCTGGG + Intronic
1169881408 20:10351164-10351186 CACAGGAGCTTCTGTCCCCATGG + Intergenic
1170125311 20:12956728-12956750 CACAGGAGCTCCTGTCCCCATGG + Intergenic
1170229584 20:14030106-14030128 CACTGCAGCCTCCAACTCCAGGG + Intronic
1170469315 20:16652803-16652825 CACTGCAGCCTCTAACCCTTGGG + Intergenic
1170505711 20:17023929-17023951 GGCAGGAGCCTCCAACCCCTGGG + Intergenic
1170526479 20:17243274-17243296 CACAGCAGCCTCCAACTCCTGGG + Intronic
1170563077 20:17574126-17574148 CACAGAAGCCTCTAACACCCAGG - Intronic
1170851776 20:20011379-20011401 CACTGGAGCCTCAAACTCCTGGG + Intergenic
1170961162 20:21027038-21027060 CACAGTAGCCTCAAACTCCTGGG + Intergenic
1171353285 20:24522148-24522170 CACTGCAGCCTCAAACCCCTGGG + Intronic
1171510450 20:25678864-25678886 CACTGCAGCCTCTAACTCCTGGG - Intronic
1172119652 20:32590477-32590499 CACTGTAGCCTCTACCTCCAGGG - Intronic
1172138012 20:32700913-32700935 CACTGCAGCCTCTAACTCCTAGG + Intergenic
1172354530 20:34270174-34270196 CACTGCAGCCTCCAACTCCAGGG - Intergenic
1172354635 20:34271047-34271069 CACTGGAGCCTCCAACTCCCAGG + Intergenic
1172431184 20:34893275-34893297 CACTGTAGCCTCAAACTCCAAGG + Intronic
1172630643 20:36376072-36376094 CACTGCAGCCTCTAACTCCTGGG + Intronic
1172753175 20:37265437-37265459 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1172770230 20:37378236-37378258 CACTGCAGCCTCAAACTCCAGGG + Intronic
1172782381 20:37444573-37444595 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1172964826 20:38827023-38827045 CACTGCAGCCTCAAACCCCTGGG + Intronic
1173011249 20:39184685-39184707 TACAGGAGCTTCTGTCCCCATGG + Intergenic
1173244492 20:41326592-41326614 CACTGCAGCCTCTACCCCCAGGG + Intergenic
1173641028 20:44602004-44602026 CACTGTAACCTCTGACCCCAGGG + Intronic
1173653126 20:44680233-44680255 CACTGCAGCCTCGAACTCCAGGG + Intergenic
1173965837 20:47112063-47112085 CACTGCAGCCTCTAACTCCTGGG - Intronic
1173992287 20:47312712-47312734 CACAGCAACCTCTGACTCCAGGG - Intronic
1174039587 20:47689432-47689454 CACAGGAGCCTCTGTCCATAGGG - Intronic
1174219641 20:48943644-48943666 CACTAGAGCCTCTAACTCCTGGG + Intronic
1174470951 20:50760346-50760368 CACTGCAGCCTCAAACTCCAAGG - Intergenic
1174543949 20:51311183-51311205 CACAGCAGCCTCCAACTCCTGGG + Intergenic
1175166964 20:57050857-57050879 CACAGCAGCCTCTAACTCCTAGG - Intergenic
1175335248 20:58191746-58191768 CCCTGGAGCCCCTAAACCCAGGG + Intergenic
1175440946 20:58990946-58990968 CACAGCTGCCTCCTACCCCAGGG + Exonic
1175551255 20:59819458-59819480 CACTGCAGCCTCTAACTCCTAGG - Intronic
1175868138 20:62192395-62192417 CATAGGAGCCTTTGTCCCCAGGG + Intronic
1176308662 21:5137751-5137773 CACTGCAGCCTCCAACCCCTGGG - Intronic
1177009665 21:15716631-15716653 CACATGAACCTCCAAACCCAAGG - Intergenic
1177152637 21:17470140-17470162 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1177820264 21:26023462-26023484 CACAGCAGCCTCGAACTCCTGGG - Intronic
1177820287 21:26023625-26023647 CACAGCAGCCTCGAACTCCTGGG - Intronic
1178348765 21:31855216-31855238 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1178602878 21:34009953-34009975 CACAGCAGCCTCCAACTCCTGGG - Intergenic
1178676297 21:34634439-34634461 CACAGGAGCTTCTGTCCCCATGG + Intergenic
1178768749 21:35482374-35482396 CAAAGGAGCCTCCAACACTAAGG + Intronic
1178798664 21:35770467-35770489 CACTGCAGCCTCAAACCCCTGGG - Intronic
1178906527 21:36641625-36641647 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1178918756 21:36724352-36724374 CACTGGAGCCTCAAACTCCTGGG + Intronic
1178985348 21:37298471-37298493 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1179231505 21:39507719-39507741 CACAGCAGCCTCAAACTCCTGGG + Intronic
1179448337 21:41449730-41449752 CACAGAAGCTTCTGTCCCCACGG + Intronic
1179848397 21:44124281-44124303 CACTGCAGCCTCCAACCCCTGGG + Intronic
1180029982 21:45200329-45200351 CATGGGAGCCTCTCACCCCATGG - Intronic
1180124018 21:45775491-45775513 CACTGCAGCCTCAAACCCCTGGG + Intronic
1180216602 21:46327474-46327496 CACTGCAGCCTCAAACCCCTGGG + Intronic
1180224702 21:46385278-46385300 CACTGTAGCCTCAAACTCCAGGG - Intronic
1180246000 21:46547743-46547765 CACTGGAGCCTCTACCTCCTGGG + Intronic
1180672666 22:17565447-17565469 CACTGCAGCCTCCAACCCCAGGG + Intronic
1180824855 22:18855166-18855188 CACTGCAGCCTCTAACTCCTGGG + Intronic
1181105572 22:20572847-20572869 CACTGCAGCCTCAAACCCCTGGG - Intronic
1181125276 22:20698317-20698339 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1181154449 22:20909960-20909982 CACTGCAGCCTCTACCTCCAGGG - Intergenic
1181187874 22:21119382-21119404 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1181211324 22:21291111-21291133 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1181273063 22:21671973-21671995 CACTGCAGCCTCCAACCCCTGGG - Intronic
1181398179 22:22635776-22635798 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1181500916 22:23315146-23315168 CACTGCAGCCTCTAACTCCTGGG - Intronic
1181651232 22:24260284-24260306 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1181692198 22:24569872-24569894 CACAAGAGCTTCTAGCCCCATGG + Intronic
1181706147 22:24650455-24650477 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1181732661 22:24859039-24859061 CACACGCACCTATAACCCCAAGG - Intronic
1181794185 22:25292276-25292298 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1181816948 22:25445705-25445727 CACTGCAGCCTCGAACTCCAGGG + Intergenic
1181834187 22:25588842-25588864 CACTGCAGCCTCAAACCCCTGGG + Intronic
1181965250 22:26652067-26652089 CACTGCAGCCTCTAACGCCTAGG + Intergenic
1181990518 22:26833440-26833462 CACTGCAGTCTCTAACTCCAGGG + Intergenic
1182037355 22:27209859-27209881 CACTGCAGCCTCGAACCCCTGGG + Intergenic
1182101685 22:27662200-27662222 CACTGCAGCCTCTGCCCCCAAGG - Intergenic
1182198315 22:28542011-28542033 CACTGCAGCCTCTAACTCCAGGG - Intronic
1182445012 22:30384885-30384907 CACTGCAGCCTCTACCCCCGGGG + Intronic
1182492915 22:30685469-30685491 AACCTGAGCCTCCAACCCCAAGG - Intergenic
1182668955 22:31979850-31979872 CACTGCAGCCTCCAACCCCTGGG - Intergenic
1182746785 22:32612071-32612093 GACAGGAGCTTCTATCACCATGG - Intronic
1183179834 22:36252621-36252643 CACAGCAGCTTCAAACCCCTGGG - Intergenic
1183429817 22:37758774-37758796 CACAGCGGCCTCTACCCCTAGGG + Intronic
1183932519 22:41244092-41244114 CACTGCAGCCTCTACCCCCCGGG - Intergenic
1183971482 22:41480889-41480911 CACAGCAGCCTCAAACTCCTGGG + Intronic
1184205019 22:42996614-42996636 CACTGCAGCCTCCAACTCCAGGG - Intronic
1184319306 22:43727350-43727372 CACTGCAGCCTCAAACCCCTGGG - Intronic
1184611532 22:45606993-45607015 CACAGGAGCTTCTGTCCCCGTGG - Intergenic
1184689185 22:46109786-46109808 CGCAGGAGCTTCTGTCCCCAGGG - Intronic
1184760893 22:46543547-46543569 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1184817695 22:46884598-46884620 CACAGGGGCCACCAAGCCCAGGG - Intronic
1185014502 22:48335181-48335203 CACAGGAGCCTCCAGCTGCAGGG - Intergenic
1203215625 22_KI270731v1_random:4320-4342 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1203275001 22_KI270734v1_random:81071-81093 CACTGCAGCCTCTAACTCCTGGG + Intergenic
949090807 3:26547-26569 CACTGCAGCCTCAAACTCCAGGG - Intergenic
949188340 3:1220258-1220280 CACAGAAGCCTCTAACTCCTGGG - Intronic
949546102 3:5073983-5074005 CACAGCAGCCTCAAACTCCTGGG - Intergenic
949849802 3:8411421-8411443 CACTGCAGCCTCTATCTCCAGGG - Intergenic
950453909 3:13081342-13081364 CACAGAAGCCTCAAACTCCTAGG + Intergenic
950808221 3:15626699-15626721 CACAGCAGCCTCAAACTCCTAGG - Intronic
951487647 3:23231889-23231911 CACAGGAGCTTCTCTACCCATGG + Intronic
951532191 3:23708199-23708221 CACTGGAGCCTCTGCCCCCCAGG - Intergenic
951589742 3:24250623-24250645 CACTGCAGCCTCAAACGCCAAGG - Intronic
951711907 3:25591963-25591985 CACAAGAGCCTCAAACCCACTGG - Intronic
951873251 3:27390897-27390919 CACAGCAGCCTCAAACTCCTGGG + Intronic
951880168 3:27473221-27473243 CACAGGAGCCTTGAACTCCTGGG - Intronic
952362461 3:32644761-32644783 CACTGCAGCCTCTAACTCCTGGG - Intergenic
952801803 3:37299973-37299995 CACTGTAGCCTCTAACTCCTGGG - Intronic
952832270 3:37575124-37575146 CACAGATGCTTCTCACCCCAAGG + Intronic
952888904 3:38028550-38028572 CACTAAAGCCTCCAACCCCAAGG + Intronic
953021455 3:39116549-39116571 CACTGCAGCCTCGAACCCCTGGG + Intronic
953226100 3:41022825-41022847 CACAGCAGCCTCAAACTCCTGGG + Intergenic
953313838 3:41907370-41907392 CACTGCAGCCTCAAACTCCAGGG + Intronic
953364912 3:42336029-42336051 CACAGGAGTGTCTGTCCCCATGG - Intergenic
953423275 3:42771677-42771699 CACAGTAGCCTCCAACCCCTGGG - Intronic
953852151 3:46472604-46472626 CACAGCAGCCTCGAACTCCCAGG + Intronic
953965095 3:47298277-47298299 CACCGCAGCCTCTAACTCCTGGG - Intronic
953973325 3:47363780-47363802 CACTTGAGCCTCTAACTCCTAGG - Intergenic
954131684 3:48564310-48564332 CACACAAGCCTCTAGCACCAAGG + Exonic
954150138 3:48653208-48653230 CACATGGGGCTCTAACCCCAGGG - Intronic
954192284 3:48972243-48972265 CACTGCAGCCTCAAACCCCTGGG + Intronic
954205352 3:49054824-49054846 CACTGTAGCCTCTAACTCCTGGG - Intronic
954309233 3:49752079-49752101 CACTGCAGCCTCTAACTCCTGGG + Intronic
954460118 3:50621695-50621717 CACTGCAGCCTCAAACCCCTAGG - Intronic
954634064 3:52062149-52062171 CACAGCAGCCTCGAACTCCTGGG + Intergenic
954730739 3:52659495-52659517 CACTGCAGCCTCTAACTCCAGGG + Intronic
954878162 3:53816919-53816941 CACAGGAGCCTCAACCTCCTGGG + Exonic
955173368 3:56586978-56587000 CACTGCAGCCTCTAACTCCTGGG - Intronic
955380047 3:58431117-58431139 CACTGCAGCCTCTAACTCCTAGG + Intronic
955508216 3:59653274-59653296 CACTGTAGCCTCAAACTCCAGGG + Intergenic
955706016 3:61728505-61728527 CACTGCAGCCTCTAACTCCTAGG - Intronic
956224262 3:66938100-66938122 CACTGCAGCCTCGAACCCCTGGG - Intergenic
956360908 3:68445975-68445997 CACTGCAGCCTCAAACTCCAGGG + Intronic
956661895 3:71607117-71607139 CACTGAAGCCTCAAACTCCAGGG + Intergenic
956820141 3:72946897-72946919 CACTGCAGCCTCAAACTCCAGGG + Intronic
956915228 3:73863882-73863904 CACAGTAGCCTATAAGCCCCAGG + Intergenic
957031128 3:75242760-75242782 CACTGCAGCCTCAAACTCCAGGG - Intergenic
957196231 3:77071921-77071943 AACAGGAGTCTCCAACCCCTGGG + Intronic
957211289 3:77261841-77261863 CACTGCAGCCTCAAACCCCTGGG + Intronic
958111385 3:89150898-89150920 CACTGCAGCCTCTAACTCCTGGG - Intronic
958899005 3:99863374-99863396 TACAGGAGTCCCCAACCCCAGGG - Intronic
959096215 3:101958942-101958964 CACTGCAGCCTCAAACCCCTAGG - Intergenic
959406594 3:105968582-105968604 CACTGCAGCCTCTAACTCCTGGG - Intergenic
959445145 3:106430163-106430185 CACTGCAGCCTCAAACTCCAGGG + Intergenic
959524138 3:107357146-107357168 CACAGCAGCCTCAAACTCCTAGG - Intergenic
959564144 3:107817030-107817052 CACTGCAGCCTCGAACTCCAGGG - Intergenic
960630188 3:119722562-119722584 CACTGCAGCCTCAAACCCTATGG + Intronic
960820834 3:121729487-121729509 CACTGCAGCCTCTAACTCCCAGG + Intronic
961139931 3:124547386-124547408 CACTGCAGCCTCCAACTCCAGGG + Intronic
961263709 3:125623205-125623227 CACTGTAGCCTCTACCTCCAGGG + Intergenic
961425962 3:126848053-126848075 CACCGCAGCCTCAAACTCCAGGG + Intronic
961492996 3:127268263-127268285 CACAGGAGCTTCTGTCCCCTTGG + Intergenic
961501638 3:127340411-127340433 CCCAGGAGCCTCTAGTCACAGGG + Intergenic
961708924 3:128811771-128811793 CACTGCAGCCTCTAACTCCTGGG - Intronic
961769049 3:129234951-129234973 CACAGCAGCCTCCAACCCCCAGG - Intergenic
961797029 3:129416723-129416745 CACTGCAGCCTCTAACTCCCGGG + Intronic
961799855 3:129439456-129439478 CCTAGGATCCTCCAACCCCAAGG + Intronic
962126416 3:132624228-132624250 CACTGCAGCCTCAAACTCCAGGG - Intronic
962791784 3:138817878-138817900 CACTGCAGCCTCAAACTCCAGGG - Intronic
963189316 3:142451653-142451675 CACAGCAGCCTCCAACTCCTGGG + Intronic
963192140 3:142484466-142484488 CACAGGAGCTTCTGTCTCCATGG - Intronic
964447760 3:156778216-156778238 CACTGTAGCCTCTAATCCCTGGG - Intergenic
964461590 3:156937064-156937086 CACAGCAGCCTCAAACTCCTGGG - Intronic
965366328 3:167804765-167804787 CACTGCAGCCTCGAACCCCCAGG - Intronic
966038421 3:175449152-175449174 CACTGCAGCCTCAAACCCCTGGG + Intronic
966247558 3:177825805-177825827 CACAGCAGCCTCAAACTCCTGGG + Intergenic
966393202 3:179474825-179474847 CACTGCAGCCTCAAACTCCAAGG + Intergenic
966528997 3:180952906-180952928 CACTGCAGCCTCCAACCCCTGGG + Intronic
966782625 3:183596977-183596999 CACTGCAGCCTCTAACTCCTGGG - Intergenic
967197083 3:187037652-187037674 CACTGCAGCCTCTAACTCCTGGG + Intronic
967708488 3:192679528-192679550 CACTGCAGCCTCAAACTCCAGGG - Intronic
968023607 3:195418498-195418520 CACTGCAGCCTCAAACTCCAAGG + Intronic
968168986 3:196493428-196493450 CACTGCAGCCTCCAACCCCTTGG + Intronic
968349735 3:198043986-198044008 CACTGCAGCCTCTAACTCCCCGG - Intergenic
969017289 4:4111973-4111995 CACAGCAGCCTCTACCTCCTGGG - Intergenic
969040329 4:4290495-4290517 CGCAGGAGCCGCCAACCCCCCGG - Intronic
969079735 4:4609139-4609161 CACTGCAGCCTCAAACCCCTGGG - Intergenic
969090341 4:4689359-4689381 CACTGCAGCCTCAAACTCCAAGG - Intergenic
969286896 4:6208181-6208203 CACTGCAGCCTCTACCTCCAGGG - Intergenic
969439816 4:7210355-7210377 CACTGCAGCCTCCAACCCCTGGG + Intronic
969489835 4:7492846-7492868 CTGCGGAGCCTCTGACCCCAGGG + Intronic
969997281 4:11325924-11325946 CACTGCAGCCTCGAACCCCTGGG + Intergenic
970191874 4:13525161-13525183 CTCAGGGGCCTCCAACCGCATGG + Intergenic
970317904 4:14846946-14846968 CACTGTAGCCTCTAACTCCTAGG + Intergenic
970365711 4:15355931-15355953 CACTGCAGCCTCTAACTCCTGGG + Intronic
970723523 4:19015893-19015915 CACTGCAGCCTCTAACTCCTCGG - Intergenic
970931943 4:21522440-21522462 CACTGCAGCCTCTAACTCCTGGG + Intronic
971120558 4:23699766-23699788 CACTGTAGCCTCAAACTCCAGGG - Intergenic
971366194 4:25978922-25978944 CACTGCAACCTCTAACCCCTGGG - Intergenic
971558011 4:28038231-28038253 CACTGCAGCCTCCACCCCCAAGG + Intergenic
971697375 4:29924241-29924263 CACTGCAACCTCCAACCCCAGGG + Intergenic
972316159 4:37927819-37927841 CACTGCAGCCTCGAACCCCTGGG - Intronic
972382347 4:38530992-38531014 CACTGCAGCCTCTAACTCCTGGG - Intergenic
972435202 4:39026849-39026871 CACTGCAACCTCCAACCCCAGGG - Intronic
972482260 4:39508307-39508329 CACTGGAGCCTCCAACTCCTAGG + Intronic
973912224 4:55592648-55592670 CACAGCAGCCTCCACCTCCACGG + Intergenic
973918638 4:55662380-55662402 CACTGCAGCCTCAAACCCCTGGG + Intergenic
973999104 4:56492907-56492929 CACTGGAGCCTCAAACTCCTGGG - Intronic
974465756 4:62253710-62253732 CACTGCAGCCTCAAACCCCCCGG + Intergenic
975080214 4:70268264-70268286 CACTGCAGCCTCGAACCCCCAGG - Intergenic
975432004 4:74304636-74304658 CACTGCAGCCTCTACCTCCAAGG + Intergenic
975567033 4:75768090-75768112 CACTGCAGCCTCTAACTCCTGGG + Intronic
975914162 4:79303392-79303414 CACTGCAGCCTCAAACTCCAAGG + Intronic
975915371 4:79318991-79319013 CACAAGAGCCTCAAACTCCTGGG + Intronic
976459827 4:85297031-85297053 CACTGTAGCCTCGAACTCCAGGG - Intergenic
976520742 4:86022578-86022600 CACTGTATCCTCTAACTCCAGGG + Intronic
976604737 4:86972060-86972082 CACAGGAGCCTCGACCTCCTGGG - Intronic
976677495 4:87719489-87719511 CACAGGAGCTTCTGTCCCCATGG + Intergenic
976785703 4:88818057-88818079 CACTGCAACCTCTAACTCCAGGG + Intronic
976833699 4:89346152-89346174 CACTGAAGCCTCTAACTCCAAGG + Intergenic
977422431 4:96818970-96818992 CAAAGGAGCCTCAATGCCCATGG - Intergenic
977463455 4:97355442-97355464 CACTGCAGCCTCCAACTCCATGG - Intronic
977562649 4:98547927-98547949 CACTGCAGCCTCTACCTCCAGGG - Intronic
977781641 4:100987481-100987503 GACAGGAGCTTCTGTCCCCATGG + Intergenic
978180613 4:105790563-105790585 CACTGGAGCCTCAAACTCCCAGG - Intronic
978708717 4:111750369-111750391 CACAGGGGCCTGTTGCCCCAAGG - Intergenic
979163036 4:117488283-117488305 CACAGCAGCCTCAAACACCTGGG - Intergenic
979656663 4:123202945-123202967 CACTGCAGCCTCGAACCCCTAGG - Intronic
980789769 4:137605296-137605318 CACTGGAGCCTCGACCTCCAGGG + Intergenic
981864438 4:149398780-149398802 CACTGCAGCCTCAAACTCCAGGG + Intergenic
982155037 4:152511012-152511034 CACTGAAGCCTCAAACACCACGG + Intronic
982188496 4:152827749-152827771 CACAGCAGCCTCTACCTCCTGGG + Intronic
982691547 4:158553111-158553133 CACTGCAGCCTCAAACCCCTGGG - Intronic
983497531 4:168460446-168460468 CACAGGAACCTCTAAACACATGG + Intronic
984785860 4:183566663-183566685 CACAGCAGCCTCTAACTCCTGGG - Intergenic
984837119 4:184032576-184032598 CACTGCAGCCTCAAACCCCTGGG + Intergenic
984869857 4:184316359-184316381 CACTGCAGCCTCAAACCCCTGGG + Intergenic
985265109 4:188149876-188149898 CACCGAAACCTCTAACCCCTGGG + Intergenic
986164027 5:5258038-5258060 CACAGGAGCGTTTGACCCCTTGG + Intronic
986806727 5:11314424-11314446 CACTGCAGCCTCTACCTCCAGGG + Intronic
986892023 5:12320634-12320656 CACAGGAGACTTTAGCCCTAGGG - Intergenic
987080909 5:14424533-14424555 GACTTGAGCCTCTAAACCCAGGG + Intronic
987139341 5:14929507-14929529 CACAGGAGCTTCTGTCCCCGTGG - Intergenic
987236060 5:15943018-15943040 CACAGCAGCCTCTACCTCCTAGG + Intergenic
987343131 5:16955979-16956001 CACAGCAGCCTCTACCTCCCGGG - Intergenic
988457917 5:31403991-31404013 CACTGCAGCCTCGAACCCCTGGG + Intronic
988820088 5:34874645-34874667 CACAGCAGCCTCAAACTCCTGGG - Intronic
988826046 5:34936392-34936414 CACAGCAGCCTCAAACTCCTGGG + Intronic
989384295 5:40838963-40838985 CACAGCAGCCTCAAACTCCTGGG - Intergenic
989506491 5:42231598-42231620 CACAGGAGCTCCTGAGCCCAGGG + Intergenic
989601196 5:43202257-43202279 CACTGTAGCCTCAAACCCCTGGG + Intronic
989630711 5:43480387-43480409 CACTGTAGCCTCTAACTCCTAGG + Intronic
990575322 5:57118177-57118199 CACTGCAGCCTCTAACGCCTGGG - Intergenic
991076250 5:62541603-62541625 CACTGCAGCCTCCAACCCCCAGG - Intronic
991390789 5:66141540-66141562 CACTGTAGCCTCGAACCCCCAGG + Intronic
992109297 5:73477814-73477836 CACAGCAGCCTCAAACTCCTGGG + Intergenic
992285807 5:75234450-75234472 CACTGAAGCCTCTAACTCCTAGG - Intronic
992330627 5:75714304-75714326 CACTGCAGCCTCCACCCCCAGGG - Intronic
992382448 5:76251473-76251495 CACCGAAGCCTCTAACTCCTGGG - Intronic
992591898 5:78304288-78304310 CACTGAAGCCTCTAACTCCTGGG + Intergenic
992642200 5:78777774-78777796 CACTGCAGCCTCTAACTCCCAGG - Exonic
992710104 5:79444277-79444299 CACTGCAGCCTCAAACCCCTGGG + Intronic
992862296 5:80923485-80923507 CACTGGAGCCTCAAACTCCCAGG + Intergenic
992946766 5:81818966-81818988 CACTGCAGCCTCTAACTCCTGGG + Intergenic
993186049 5:84621367-84621389 CACTGCAGCCTCAAACCCCTGGG + Intergenic
993303837 5:86249991-86250013 CACTGCAGCCTCAAACTCCAGGG + Intergenic
993961280 5:94299290-94299312 CACAGCAGCCTCAAACTCCTGGG + Intronic
994203676 5:97008424-97008446 CACTGCAGCCTCAAACCCCTGGG + Intronic
994376950 5:99025852-99025874 CACAGCAGCCTCTACCCCATGGG + Intergenic
994477132 5:100285883-100285905 CACTGGAGCCTCTACCTCCTAGG + Intergenic
994962367 5:106621630-106621652 CACAGCAGCCTCAAACTCCTGGG - Intergenic
995373887 5:111451821-111451843 CACTGCAGCCTCTAACTCCTGGG - Intronic
995907844 5:117147310-117147332 CACAGCAGCCTCAAACTCCTGGG + Intergenic
995922882 5:117334550-117334572 CACAGGGGTCTCCAACCCCAGGG - Intergenic
996087094 5:119316233-119316255 CACTGCAGCCTCTAACTCCTGGG + Intronic
996570081 5:124924239-124924261 CACTGCAGCCTCGAACTCCAGGG + Intergenic
996720044 5:126621262-126621284 CACTGTAGCCTCAAACTCCAGGG + Intronic
997143561 5:131408521-131408543 TACTGCAGCCTCTAACTCCAGGG + Intergenic
997193469 5:131961619-131961641 CACTGCAGCCTCTACCCCCAGGG - Intronic
997604977 5:135168270-135168292 CACCGCAGCCTCAAACCCCTGGG - Intronic
997958972 5:138304242-138304264 CACTGCAGCCTCAAACCCCTGGG + Intronic
998008174 5:138671432-138671454 CACTGCAGCCTCTAACTCCTGGG + Intronic
998140738 5:139698052-139698074 CACAGGAGACTCTAAATCCCGGG + Intergenic
998241366 5:140448122-140448144 CACTGCAGCCTCAAACTCCAAGG - Intronic
998781742 5:145664672-145664694 CACTGTAGCCTTTAACCCAATGG + Intronic
999297802 5:150471267-150471289 CACTGCAGCCTCAAACCCCTGGG + Intergenic
999311060 5:150552561-150552583 CACAGTAGCCTCGACCCCCTGGG + Intronic
999313391 5:150568427-150568449 CACTGCAGCCTCTAACTCCTGGG + Intergenic
999396682 5:151233863-151233885 CACTGCAGCCTCAAACTCCAGGG + Intronic
999447583 5:151652509-151652531 CACAGCAGCCTCCAACTCCCAGG + Intergenic
999708357 5:154294256-154294278 CACTGCAGCCTCGAACTCCAGGG - Intronic
999742608 5:154567906-154567928 CACTGCAGCCTCTAACTCCTGGG - Intergenic
999777408 5:154822180-154822202 CACTGCAGCCTCCAACCCCTGGG - Intronic
1000019344 5:157305584-157305606 CACTGCAGCCTCTAACTCCCAGG + Intronic
1000311847 5:160052409-160052431 CACTGCAGCCTCTAACCCTTGGG - Intronic
1000618637 5:163458513-163458535 CACAGCAGCCTCAAACCCATGGG - Intronic
1001092996 5:168755508-168755530 CACTGCAGCCTCTGCCCCCAGGG + Intronic
1001602101 5:172935445-172935467 CACAGGAGGCTTCGACCCCAAGG + Intronic
1001755269 5:174163791-174163813 TACAGGAGCTTCTGTCCCCATGG + Intronic
1002261077 5:177994511-177994533 CACTGCAGCCTCGAACCCCTGGG + Intronic
1002317662 5:178354282-178354304 CACAGCAGCCTCCAACTCCTGGG + Intronic
1002366762 5:178718806-178718828 CACTGCAGCCTCAAACTCCAGGG + Intronic
1002499179 5:179636132-179636154 CACTGGAGCCTCCAACTCCTGGG - Intergenic
1002502497 5:179656389-179656411 CACTGGAGCCTCCAACTCCTGGG + Intergenic
1002627909 5:180544881-180544903 CACAGTAGCCTTTAACTCCTAGG - Intronic
1003060219 6:2857200-2857222 CAGAGGCCCCTCTAACTCCAAGG - Intergenic
1003277336 6:4663936-4663958 CACTGTAGCCTCTAACTCCTGGG - Intergenic
1003279143 6:4676935-4676957 CACTGTAGCCTCTAACTCCTAGG - Intergenic
1003283946 6:4717919-4717941 CACAAGAGCCTCAACCCCCTGGG + Intronic
1003504196 6:6726113-6726135 CCAGGGAGCCTCTAACCCCGGGG + Intergenic
1003645140 6:7908759-7908781 CACTGTAGCCTCTAACTCCTGGG - Intronic
1003828098 6:9974833-9974855 CACAGGAGCTTCTGTCTCCATGG + Intronic
1003946428 6:11080299-11080321 CACAGGAGCTTCTGTCCCCATGG + Intergenic
1004019260 6:11761840-11761862 CAGAGGAGCCTCTTCCCTCAAGG + Intronic
1004545646 6:16596070-16596092 CACTGCAGCCTCTAACTCCTGGG + Intronic
1004626789 6:17384601-17384623 CACAGTAGCCTCGAACTCCTGGG - Intergenic
1004715217 6:18210431-18210453 CACAGCAGCCTCGAACTCCTGGG + Intronic
1004785147 6:18960326-18960348 CACAGGAGCCTGGAACACAAGGG - Intergenic
1004806169 6:19205755-19205777 CACAGGAGACTTTAGCCCTAGGG - Intergenic
1004900051 6:20185172-20185194 CACTGTAGCCTCAAACCCCTGGG - Intronic
1004918087 6:20350864-20350886 CAAAGGATCCTCTCACCTCAGGG + Intergenic
1005361263 6:25033126-25033148 CACTGCAGCCTCGAACCCCTGGG - Intronic
1005665793 6:28052989-28053011 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1005921373 6:30404961-30404983 CACACGACCCTCTGTCCCCATGG - Intergenic
1005974877 6:30790330-30790352 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1006006052 6:31002453-31002475 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1006041705 6:31261463-31261485 CACAGGAGCCTCTGTCCCCATGG - Intergenic
1006051366 6:31347370-31347392 CACAAGAGCCTCTGTCCCCACGG - Intronic
1006482635 6:34310155-34310177 CACTGGAGCCTCAAACTCCTGGG - Intronic
1006522126 6:34576941-34576963 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1006852477 6:37108982-37109004 CACTGTAGCCTCGAACTCCAGGG + Intergenic
1006934709 6:37709468-37709490 CACTGCAGCCTCAAACCCCCAGG - Intergenic
1006955852 6:37870757-37870779 CACTGCAGCCTCAAACCCCTGGG + Intronic
1007583475 6:42973786-42973808 CACTGCAGCCTCTACCTCCATGG - Intronic
1007880667 6:45162446-45162468 CACTGGAGCCTCAAACCTCTGGG - Intronic
1007950335 6:45866533-45866555 CACAGGAGCCTCTACCAAAATGG - Intergenic
1008052032 6:46909930-46909952 CACTGCAGCCTCGAACTCCAGGG - Intronic
1008718211 6:54315599-54315621 CACAGAAGCCTCAAACTCCTGGG - Intronic
1008789611 6:55214405-55214427 CACTGCAGCCTCAAACTCCAAGG + Intronic
1008882996 6:56400356-56400378 CACAGGAGCCACTGCCCTCATGG - Intergenic
1009692920 6:67059718-67059740 CACTGAATCCTCTACCCCCAAGG + Intergenic
1010195390 6:73234695-73234717 CACAGCAGCCTCAAACTCCTGGG + Intronic
1011080750 6:83488042-83488064 CACAGCAGCCTCAAACTCCTGGG - Intergenic
1011208740 6:84931400-84931422 CACAGCAGCCTCGAACTCCCAGG + Intergenic
1011238401 6:85243329-85243351 CACTGAAGCCTCTAACTCCTGGG - Intergenic
1011252872 6:85391788-85391810 CACTGCAGCCTCCAACCCCTGGG + Intergenic
1011484821 6:87830278-87830300 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1011530976 6:88320713-88320735 CACAGTAGCCTCGAACTCCTGGG - Intergenic
1011584759 6:88912331-88912353 CACAGCAGCCTCAAGCTCCAGGG - Intronic
1011596945 6:89025384-89025406 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1011798379 6:90982613-90982635 CACAGGTGCCTCAGACACCAAGG - Intergenic
1011945588 6:92898284-92898306 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1012051135 6:94345195-94345217 CACAGCAGCCTCCAACTCCTGGG - Intergenic
1012096858 6:94972958-94972980 CACAGGATCCTGTAGCCTCAGGG + Intergenic
1012411750 6:98966707-98966729 CACTGAAGCCTCTAACTCCCAGG + Intergenic
1012781514 6:103564377-103564399 CACTGGAGCCTCCAACTCCTTGG - Intergenic
1012831119 6:104204529-104204551 CACAGGAGCTTCTCTTCCCATGG + Intergenic
1013104364 6:107014112-107014134 CACAGGAGTCTCCAACCCCTGGG - Intergenic
1013191417 6:107806944-107806966 CACAGGAGCACCTGAGCCCAGGG - Intronic
1013299233 6:108787575-108787597 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1013709016 6:112875326-112875348 CACAGTAGCTTCTGTCCCCATGG - Intergenic
1014214363 6:118738452-118738474 CACTGCAGCCTCTATCCCCTGGG - Intergenic
1014361065 6:120474686-120474708 CACTGCAGCCTCTACCCCCCTGG - Intergenic
1014726249 6:124975504-124975526 CACTGCAGCCTCTAACTCCCAGG + Intronic
1014847217 6:126292440-126292462 CACTGGAGCCTCCAACTCCTGGG - Intergenic
1014977215 6:127902247-127902269 CACTGTAGCCTCAAACTCCAGGG - Intronic
1015192206 6:130484067-130484089 TACAGAAGCCTCTAAGTCCAGGG - Intergenic
1015610415 6:135011442-135011464 CACAGCAGCCTCAAACTCCAGGG - Intronic
1015657471 6:135535722-135535744 CACGGCAGCCTCTATCCCCCAGG + Intergenic
1015761877 6:136671687-136671709 CACAGGAACCTCTGCCTCCAGGG + Intronic
1016295178 6:142565984-142566006 CACTGGAGCCTCCACCTCCAGGG - Intergenic
1016603771 6:145893853-145893875 GACAGGGGCCTCACACCCCAAGG - Intronic
1016888737 6:148984608-148984630 CACTGCAGCCTCAAACCCCTGGG + Intronic
1016918821 6:149271130-149271152 CACTGCAGCCTCTAACTCCTGGG - Intronic
1016995530 6:149960106-149960128 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1017003083 6:150009393-150009415 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1017012700 6:150073405-150073427 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1017020670 6:150137459-150137481 CACTGCAGCCTCTAACTCCCAGG - Intergenic
1017259010 6:152365533-152365555 CACTGCAGCCTCAAACCCCTGGG + Intronic
1017263945 6:152420542-152420564 CACAGGAACCTCTACCTCCTAGG - Intronic
1017467056 6:154704035-154704057 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1017687977 6:156932067-156932089 CACTGTAGCCTCTAACTCCCAGG - Intronic
1017735894 6:157362819-157362841 CACAGCAGCCTCAAACTCCTAGG - Intergenic
1017898654 6:158702464-158702486 CACTGTAGCCTCTCACTCCAGGG - Intronic
1018014868 6:159702940-159702962 CACTGCAGCCTCGAACCCCTGGG - Intronic
1018024859 6:159796706-159796728 CACTGTAGCCTCAAACCCCTAGG - Intronic
1018276290 6:162135210-162135232 CACTGTAGTCTCTAACCCCTAGG + Intronic
1018377717 6:163229271-163229293 CACTGCAGCCTCTAACTCCTGGG - Intronic
1018924235 6:168195213-168195235 AACAGGAGATTCTGACCCCAGGG - Intergenic
1019249415 6:170733342-170733364 CACAGCAGCCTCAAACTCCTAGG - Intergenic
1019535050 7:1524444-1524466 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1019602433 7:1891653-1891675 CACCGCAGCCTCTAACTCCTGGG + Intronic
1019654508 7:2183135-2183157 CACAGCAGCCTCTAACTCCTGGG - Intronic
1019679936 7:2341594-2341616 CACTGCAGCCTCTAACTCCTGGG - Intronic
1019717166 7:2544574-2544596 CACTGTAGCCTCGAACCCCTGGG + Intronic
1019779983 7:2933955-2933977 CACAGCAGCCTCCAACTCCTGGG + Intronic
1019796356 7:3051963-3051985 CACAGCAGCCTCCAAATCCAGGG - Intergenic
1019948334 7:4348374-4348396 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1019983408 7:4638358-4638380 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1019985528 7:4652696-4652718 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1020077015 7:5264986-5265008 CACTGTAGCCTCGAACCCCTAGG + Intergenic
1020266113 7:6561177-6561199 CACTGCAGCCTCCAACTCCAAGG + Intergenic
1021188527 7:17593550-17593572 CACTGGAGCCTCGAACTCCTGGG - Intergenic
1021587523 7:22225080-22225102 CACTGCAGCCTCTAACTCCTGGG - Intronic
1021680871 7:23129885-23129907 AAAAGGAGCCTCTAAATCCAAGG - Intronic
1021710262 7:23409225-23409247 CACAGGGGTCCCTAACCCCCAGG - Intronic
1022016996 7:26358667-26358689 CACTGCAGCCTCAAACTCCAGGG - Intronic
1022149656 7:27588402-27588424 CACTGTAGCCTCTAACTCCTGGG + Intronic
1022706915 7:32810421-32810443 CACTGCAGCCTCCAACCCCTAGG - Intergenic
1022899789 7:34794961-34794983 CACTGTAGCCTCTAACCCCTGGG - Intronic
1023040740 7:36170995-36171017 CACAGCAGCCTCAAACTCCGAGG + Intronic
1023318758 7:38970692-38970714 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1023658938 7:42453904-42453926 CAGACGAGCTTCTAAACCCAAGG + Intergenic
1023737420 7:43247560-43247582 CACTGCAGCCTCTAACTCCTGGG - Intronic
1023754153 7:43400158-43400180 CACTGTAGCCTCTAACCCCTGGG - Intronic
1023910892 7:44555662-44555684 CACAGCAGCCTCAAACTCCTGGG - Intergenic
1024103356 7:46056585-46056607 CACAGGAGCTTCTGTCCCCATGG - Intergenic
1024357203 7:48426397-48426419 CTGAGGAGCCCCTAACCACAGGG - Intronic
1024885873 7:54141496-54141518 CACAGGAGTTTCTGATCCCATGG + Intergenic
1025118008 7:56274998-56275020 CACTGCAGCCTCCAACCCCTGGG - Intergenic
1025245530 7:57313720-57313742 CACTGCAGCCTCTAACTCCCAGG - Intergenic
1025836155 7:65095593-65095615 CACAGCAGCCTCTGCCCCCCGGG + Intergenic
1025905929 7:65785036-65785058 CACAGCAGCCTCTGCCCCCTGGG + Intergenic
1026011084 7:66636695-66636717 CACTGCAGCCTCTAACTCCTGGG - Intronic
1026016346 7:66673801-66673823 CACTGCAGCCTCTAACTCCTGGG - Intronic
1026058941 7:67009083-67009105 CACTGTATCCTCTAACCCCTGGG + Intronic
1026060572 7:67021984-67022006 CACTGCAGCCTCTAACTCCTGGG + Intronic
1026071029 7:67119861-67119883 CACTGGAGCCTCCAACTCCTGGG + Intronic
1026144187 7:67731515-67731537 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1026174462 7:67984008-67984030 CACGGCAGCCTCGAACTCCAGGG - Intergenic
1026195462 7:68169437-68169459 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1026206365 7:68261199-68261221 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1026295679 7:69050020-69050042 CACAGAAGCCTCGAACTCCTGGG - Intergenic
1026327143 7:69320584-69320606 AAGAGGAGCCTCTCAACCCATGG + Intergenic
1026333642 7:69375033-69375055 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1026339157 7:69420562-69420584 CACTGCAGCCTCTAACTCCTAGG - Intergenic
1026339552 7:69423644-69423666 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1026572036 7:71539774-71539796 CTCAGCAGCCTCTAACTCCTGGG + Intronic
1026604262 7:71802536-71802558 CACTGCAGCCTCGAACCCCTGGG + Intronic
1026613552 7:71881995-71882017 CACTGTAGCCTCTAACTCCTGGG - Intronic
1026645692 7:72166275-72166297 CACTGCAGCCTCTAACTCCTAGG + Intronic
1026651892 7:72222943-72222965 CACTGCAGCCTCTAACTCCTGGG - Intronic
1026680377 7:72462255-72462277 CACTGGAGCCTCAAACTCCTAGG + Intergenic
1026705870 7:72692436-72692458 CACTGGAGCCTCCAACTCCTGGG - Intronic
1026717746 7:72804762-72804784 CACTGCAGCCTCTAACTCCTGGG - Intronic
1026719149 7:72815951-72815973 CACTGTATCCTCTAACCCCTGGG - Intronic
1026737085 7:72955746-72955768 CACTGCAGCCTCGAACTCCAGGG + Intergenic
1026787285 7:73309735-73309757 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1026862469 7:73799933-73799955 CACTGCAGCCTCAAACTCCAGGG + Intronic
1026946528 7:74319743-74319765 CACTGCAGCCTCCAACCCCTGGG - Intronic
1027045842 7:74990995-74991017 CACTGCAGCCTCTAACTCCTGGG - Intronic
1027053447 7:75033780-75033802 CACTGGAGCCTCCAACTCCTGGG - Intronic
1027106647 7:75409322-75409344 CACTGCAGCCTCGAACTCCAGGG - Intronic
1027180914 7:75938681-75938703 CACTGCAGCCTCTAACTCCTGGG - Intronic
1027201704 7:76068134-76068156 CACTGCAGCCTCCAACCCCTGGG + Intergenic
1027208773 7:76126431-76126453 CACTGGAGCCACTAACTCCTAGG + Intergenic
1027263017 7:76478486-76478508 CACTGCAGCCTCTAACTCCTGGG + Intronic
1027265532 7:76493301-76493323 CACTGCAGCCTCCAACCCCTGGG + Intronic
1027314400 7:76976591-76976613 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1027316903 7:76991418-76991440 CACTGCAGCCTCCAACCCCTGGG + Intergenic
1027464692 7:78501010-78501032 CACAGCAGCCTCAACCTCCAAGG - Intronic
1027585404 7:80051100-80051122 CACAGCAGCCTCCAACTCCTGGG - Intergenic
1027833381 7:83209894-83209916 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1028598158 7:92568810-92568832 CACTGCAGCCTCAAACTCCAGGG + Intronic
1029108346 7:98196311-98196333 CTCAGGAGCCTCTGAGCTCAGGG + Intronic
1029174338 7:98653326-98653348 CACTGCAGCCTCAAACCCCCAGG - Intergenic
1029253498 7:99253189-99253211 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1029348647 7:99997325-99997347 CACTGCAGCCTCTGACTCCAGGG + Intergenic
1029386979 7:100249572-100249594 CACTGCAGCCTCTAACTCCTGGG + Intronic
1029613297 7:101639426-101639448 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1029731927 7:102444193-102444215 CACTGCAGCCTCTAACTCCGGGG + Intronic
1029940611 7:104477064-104477086 CACTGAAGCCTCCAACTCCAGGG + Intronic
1029989881 7:104953335-104953357 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1030650980 7:112115755-112115777 CACTGCAGCCTCTAACTCCTAGG + Intronic
1030658173 7:112191164-112191186 CACTGCAGCCTCAAACTCCAGGG + Intronic
1031494087 7:122425053-122425075 CACTGCAGCCTCGAACCCCCAGG + Intronic
1031993632 7:128213764-128213786 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1032008937 7:128329024-128329046 CACTGAAGCCTCTAACTCCTGGG + Intronic
1032065325 7:128764988-128765010 CACAGCAGCCTCGATCTCCAAGG + Intronic
1032163812 7:129530259-129530281 CACTGGAGCCTCGAACTCCTGGG - Intergenic
1032193650 7:129778186-129778208 CCCAGCAGCCTCTAGCCCCTGGG - Intergenic
1032335678 7:131022443-131022465 CACTGTAGCCTCTAACTCCTTGG + Intergenic
1032621548 7:133538753-133538775 CACTGCAGCCTCTAACTCCTGGG - Intronic
1032642670 7:133787240-133787262 CACTGCAGCCTCTAACTCCTGGG + Intronic
1033073278 7:138224227-138224249 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1033116097 7:138626768-138626790 CACTGCAGCCTCTAACTCCTGGG - Intronic
1033162365 7:139009020-139009042 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1033352367 7:140572077-140572099 CACTGCAGCCTCTAACTCCTGGG + Intronic
1033369876 7:140697908-140697930 CACTGCAGCCTCTAACTCCTGGG + Intronic
1033424313 7:141229799-141229821 CACAGCAGCCTCAAACACCTAGG - Intronic
1033613101 7:142984632-142984654 CATAGGAGACTTTAACCCTAGGG - Intergenic
1033913859 7:146299457-146299479 CACAGCAGCCTAGAACCCCTGGG + Intronic
1033970281 7:147030806-147030828 CACTGCAGCCTCAAACCCCTGGG - Intronic
1034154594 7:148946140-148946162 CACTGCAGCCTCGAACCCCTGGG + Intergenic
1034625394 7:152488270-152488292 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1034764243 7:153702979-153703001 CACTGCAGCCTCTACCTCCATGG - Intergenic
1035081036 7:156216135-156216157 CACAGGATCCTCTAACCTCGAGG + Intergenic
1035163682 7:156970202-156970224 CACTGCAGCCTCTACCTCCAGGG - Exonic
1035178156 7:157068228-157068250 CACTGAAGCCTCAAACCCCTGGG - Intergenic
1035196349 7:157224082-157224104 CACAGCAGCCTCAAACTCCTGGG + Intronic
1035788199 8:2279119-2279141 CACAGGAGCATCTGGCCCCATGG - Intergenic
1035804608 8:2442586-2442608 CACAGGAGCATCTGGCCCCATGG + Intergenic
1035938103 8:3865163-3865185 CAGAGGTGCCTCTACACCCAAGG - Intronic
1036187350 8:6635517-6635539 CACTGCAGCCTCTAACTCCTGGG - Intronic
1036414236 8:8531911-8531933 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1036420579 8:8591863-8591885 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1036968712 8:13330038-13330060 CACTGCAGCCTCTAACTCCTAGG + Intronic
1037010044 8:13830103-13830125 CACTGCAGCCTCTAACTTCAGGG + Intergenic
1037288146 8:17322747-17322769 CACAGCAGCCTCTGACTCCTGGG - Intronic
1037416546 8:18656793-18656815 CACAACAGCCTCAAACTCCAGGG + Intronic
1037454476 8:19049613-19049635 CACAGCAGCCTCAAACTCCTGGG - Intronic
1037567891 8:20132880-20132902 CACTGTAGCCTCTAACTCCTGGG + Intergenic
1037760139 8:21736569-21736591 CACAGCAGCCTCGAACTCCTGGG + Intronic
1038167556 8:25100506-25100528 CACAGAAGCTTCTGTCCCCATGG + Intergenic
1038314652 8:26473715-26473737 CACTGCAGCCTCAAACCCCTGGG + Intronic
1038322321 8:26538870-26538892 CCCAGTAGCCTTTAACACCAAGG + Intronic
1038393186 8:27224199-27224221 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1038759368 8:30372466-30372488 CACAGCAGCCTCAAACTCCTAGG + Intergenic
1038801720 8:30755323-30755345 CACTGCAGCCTCAAACTCCAGGG + Intronic
1038850198 8:31268309-31268331 CACAGGAGCTTCTGTCCCCGTGG + Intergenic
1038932865 8:32214565-32214587 CACTGCAGCCTCGAACCCCTGGG - Intronic
1039181925 8:34876801-34876823 CACTGCAGCCTCTAACTCCTAGG + Intergenic
1039264371 8:35808782-35808804 CATAGGAGACTTTAACCCTAGGG + Intergenic
1039270250 8:35872787-35872809 TAGTGGAGCCTCTAGCCCCAGGG + Intergenic
1039403143 8:37289965-37289987 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1039495636 8:37978049-37978071 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1039502533 8:38029536-38029558 CACTGGAGCCTCAAACCCCTGGG + Intergenic
1039762237 8:40590093-40590115 CACTGCAGCCTCGAACTCCAGGG + Intronic
1039767059 8:40640050-40640072 CACTGTAGCCTCAAACCCCTGGG + Intronic
1039816873 8:41101977-41101999 CACTGGAGCCTCGAACTCCTGGG + Intergenic
1039908642 8:41806627-41806649 CACTGCAGCCTCTAACTCCCAGG - Intronic
1040387071 8:46920964-46920986 CACAGGAGGCTGTGACCTCAGGG + Intergenic
1040516216 8:48137164-48137186 CACAGGAGCCCGTAACAGCAGGG + Intergenic
1040709374 8:50169863-50169885 CACTGCAGCCTCTAACTCCTCGG - Intronic
1040977981 8:53215143-53215165 CATAGGAGACTTTAACACCAGGG - Intergenic
1041047559 8:53901771-53901793 CACTGCAGCCTCAAACCCCTGGG - Intronic
1041290403 8:56302904-56302926 CACAGCAGCCTCAAACTCCCAGG - Intronic
1041290604 8:56304770-56304792 CACTGCAGCCTCAAACCCCTGGG + Intronic
1041423549 8:57695376-57695398 CCAGGGAGCCTCTACCCCCATGG + Intergenic
1041672600 8:60507691-60507713 CACTGTAGCCTCAAACCCCTGGG + Intergenic
1041757571 8:61331004-61331026 CACTGCAGCCTCTAACTCCTGGG - Intronic
1041910861 8:63086803-63086825 CACAGCAGCCTCCAACTCCTGGG + Intergenic
1042366520 8:67943335-67943357 CACAGCAACCTCCACCCCCAGGG + Intergenic
1042405500 8:68400634-68400656 CACAGCAGCCTCCAACTCCTGGG + Intronic
1042610191 8:70590572-70590594 CACTGTAGCCTCCAACTCCAGGG + Intronic
1043484783 8:80688130-80688152 CACTGCAGCCTCAAACCCCTGGG - Intronic
1043861901 8:85327573-85327595 CACTGCAGCCTCAAACCCCTTGG - Intergenic
1044240181 8:89879398-89879420 CACAGTAGCCTCAAACTCCTAGG - Intergenic
1044826034 8:96197964-96197986 CACTGCAGCCTCAACCCCCAAGG - Intergenic
1045221079 8:100201191-100201213 CACTGCAGCCTCTAACTCCTGGG + Intronic
1045244758 8:100433419-100433441 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1045359317 8:101417779-101417801 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1045624368 8:104025409-104025431 CACTGGAGCCTCAAACTCCTGGG - Intronic
1046221266 8:111218511-111218533 CACAGCAGCCTCTACCTCCCAGG + Intergenic
1046255850 8:111694906-111694928 CCCAGGAGCCTTTGATCCCAGGG - Intergenic
1046507911 8:115159817-115159839 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1046754034 8:117955158-117955180 CACAGAGGCTTCTATCCCCATGG + Intronic
1047050562 8:121107023-121107045 CACAGAAGCCTGTAGCCACAGGG - Intergenic
1047244995 8:123134449-123134471 CACTGCAGCCTCGAACTCCAGGG - Intronic
1047272709 8:123377191-123377213 CACAGTAGCCTCAACCCCCCAGG - Intronic
1047771046 8:128030035-128030057 CACCGCAGCCTCTAACTCCCAGG - Intergenic
1048309835 8:133312905-133312927 CACTGAAGCCTCAAACCCCCAGG - Intergenic
1048487600 8:134863121-134863143 CACGGGAGCCTGTAACTCCTGGG + Intergenic
1048902722 8:139055242-139055264 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1049097124 8:140555411-140555433 CACTGCAGCCTCTAACTCCCGGG - Intronic
1049136137 8:140902107-140902129 CACTGCAGCCTCTGACCCCCGGG + Intronic
1049581664 8:143414441-143414463 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1049627419 8:143631629-143631651 CACTGCAGCCTCTGCCCCCAGGG - Intergenic
1049644731 8:143731017-143731039 CACAGCAGCCTCCAACTCCTGGG - Intronic
1049929233 9:440092-440114 CACTGCAGCCTCTACCTCCAGGG + Intronic
1051317688 9:15859733-15859755 CACTGCAGCCTCAAACCCCTGGG + Intronic
1051345443 9:16147087-16147109 CACTGCAGCCTCAAACCCCTGGG + Intergenic
1051782810 9:20708698-20708720 CACTGCAGCCTCAAACTCCAGGG - Intronic
1051819853 9:21151742-21151764 CACTGGAGCCTCAAACTCCTGGG + Intergenic
1052555483 9:30009819-30009841 CACTGGAGCCTCTATCTCCCGGG + Intergenic
1052560832 9:30080674-30080696 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1052934659 9:34082952-34082974 CACAGCAGCCTCAAACTCCTGGG + Intergenic
1053037835 9:34840603-34840625 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1053063517 9:35049788-35049810 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1053347295 9:37387370-37387392 CACAGCAGCCTCGAACGCCTGGG + Intergenic
1054357429 9:64074900-64074922 CACTGCAGCCTGGAACCCCAGGG - Intergenic
1054781130 9:69166859-69166881 CACAGCAGCCTCCAACTCCTGGG - Intronic
1054795627 9:69298716-69298738 CACAGCAGCCTCAAACTCCTGGG - Intergenic
1055640790 9:78317326-78317348 CACTGCAGCCTCGAACCCCTGGG + Intronic
1055705362 9:78994684-78994706 GACAGCAGCCTTTCACCCCATGG + Intergenic
1056165680 9:83938817-83938839 CACTGCAGCCTCAAACCCCTGGG + Exonic
1056174567 9:84021450-84021472 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1056220932 9:84450182-84450204 CACAAGAGCCTCTGTCCCCATGG - Intergenic
1056319113 9:85419962-85419984 CACTGCAGCCTCAAACTCCAAGG - Intergenic
1056354351 9:85783708-85783730 CACTGCAGCCTCTACCTCCAAGG + Intergenic
1056828906 9:89898477-89898499 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1057431402 9:94997767-94997789 CACTGGAGCCTCAAACTCCAGGG + Intronic
1057437307 9:95053793-95053815 CACCGCAGCCTCCAACTCCAGGG + Intronic
1057456099 9:95212952-95212974 CACAGTAGCCACTGACCACATGG + Intronic
1057494504 9:95550252-95550274 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1057591715 9:96378851-96378873 CACAGCAGCCTCTACCTCCTGGG - Intronic
1057765126 9:97910024-97910046 CACAGGAGCCTCTGTCACCCAGG + Exonic
1057790358 9:98120409-98120431 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1058019630 9:100074201-100074223 CACAGGAGTCCCCAAACCCAAGG + Intronic
1058054529 9:100436222-100436244 CACTGTAGCCTCTAACTCCTTGG + Intronic
1058180808 9:101796097-101796119 CACTGAAGCCTCTAACCGCCAGG - Intergenic
1058433351 9:104939215-104939237 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1058658329 9:107246174-107246196 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1058672195 9:107369015-107369037 CACGGGAGCTTCTGTCCCCATGG - Intergenic
1059109157 9:111538412-111538434 CACTGCAACCTCTAACCCCTGGG - Intronic
1059252058 9:112894612-112894634 CACTGGAGCCTCAAACTCCCGGG - Intergenic
1059513403 9:114870251-114870273 CACAGCTGCCTCTACCCCCAGGG - Intergenic
1059823284 9:117997641-117997663 CACTGTAGCCTCTAAACCCTGGG + Intergenic
1060571146 9:124641619-124641641 CACTGCAGCCTCGAACTCCAGGG - Intronic
1060611438 9:124969016-124969038 CACTGCAGCCTCAAACCCCTGGG + Intronic
1060764258 9:126282147-126282169 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1060951431 9:127606322-127606344 CACTGGAGCCTCGACCTCCAGGG + Intergenic
1061151469 9:128830726-128830748 CACAGGAACCTCCAACTCCTGGG + Intergenic
1061440579 9:130600569-130600591 CACTGCAGCCTCTATCCCCCAGG + Intronic
1061457073 9:130706515-130706537 CACTGGAGCCTCTACCTCCCAGG + Intergenic
1061599087 9:131654624-131654646 CACTGTAGCCTCTAACTCCTGGG - Intronic
1061786036 9:133029285-133029307 CACTGCAGCCTCCAACTCCAGGG + Intergenic
1061998088 9:134198451-134198473 CACTGTAGCCTCTAACTCCCAGG - Intergenic
1062237993 9:135521824-135521846 CACAGGAGCCCTCATCCCCAGGG - Intronic
1185477979 X:426329-426351 CACAGCAGCCTCCAACTCCTGGG + Intergenic
1185502070 X:604542-604564 CACAGCAGCCTCCAACTCCTGGG - Intergenic
1185502118 X:604903-604925 CACAGCAGCCTCCAACTCCTGGG - Intergenic
1185730874 X:2460657-2460679 CACAGCAGCCTCCAACTCCCAGG + Intronic
1185751746 X:2615884-2615906 GATAAGAGCCTCTAACCCTACGG + Intergenic
1185762368 X:2698540-2698562 CACTGCAGCCTCGAACCCCCAGG + Intronic
1186051151 X:5597014-5597036 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1186084928 X:5977294-5977316 CACTGGAGCCTCAAACACCTGGG + Intronic
1186437571 X:9556111-9556133 CACTGCAGCCTCTAACTCCTGGG - Intronic
1186488221 X:9950514-9950536 CACTGCAGCCTCCAACTCCAGGG + Intergenic
1186499566 X:10040548-10040570 CACAGGAGCTTCTGTCCCTATGG + Intronic
1186689254 X:11957487-11957509 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1186819244 X:13269861-13269883 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1187073000 X:15907250-15907272 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1187162197 X:16774991-16775013 CACTGCAGCCTCTACCTCCAGGG - Intergenic
1187470594 X:19566063-19566085 CACTGCAGCCTCTAACTCCTGGG - Intronic
1188292818 X:28410051-28410073 CACAGGGGTCCCTAACCCCCAGG + Intergenic
1188800522 X:34524343-34524365 CATAGGAGCCTCTGTCCCCATGG - Intergenic
1189369636 X:40417398-40417420 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1189371522 X:40433012-40433034 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1189392473 X:40587801-40587823 CACTGCAGCCTCAAACTCCAGGG - Intronic
1189392702 X:40590111-40590133 CACTGCAGCCTCAAACTCCAGGG + Intronic
1189508427 X:41637032-41637054 CACTGCAGCCTCAAACCCCTGGG + Intronic
1189636664 X:43017986-43018008 CACAGGAGCTTCTTTCCCCACGG + Intergenic
1189796411 X:44650025-44650047 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1189997416 X:46652224-46652246 CACTGCAGCCTCTATCTCCAAGG + Intronic
1190082190 X:47365345-47365367 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1190091587 X:47442334-47442356 CAAAGGAGCCTCGAAACACACGG - Intergenic
1190175621 X:48146683-48146705 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1190182467 X:48204808-48204830 CACTGCAGCCTCAAACTCCAGGG - Intronic
1190182911 X:48208574-48208596 CACTGCAGCCTCAAACTCCAGGG + Intronic
1190186383 X:48238227-48238249 CACTGTAGCCTCAAACTCCAAGG + Intronic
1190192290 X:48287466-48287488 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1190195594 X:48315522-48315544 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1190195781 X:48317177-48317199 CACTGTAGCCTCAAACTCCAAGG + Intergenic
1190662042 X:52663730-52663752 CACTGCAGCCTCAAACTCCAGGG - Intronic
1190668534 X:52717866-52717888 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1190670883 X:52740538-52740560 CACTGCAGCCTCAAACTCCAGGG + Intergenic
1190748825 X:53343414-53343436 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1191750478 X:64536772-64536794 CAAAAGAGCCTATAACCCCATGG + Intergenic
1192894964 X:75432906-75432928 CACAGCAGCCTCGAACTCCTGGG - Intronic
1193076605 X:77362514-77362536 CACAGGAGACCCTATCCCTAGGG - Intergenic
1193127254 X:77882889-77882911 CACTGCAGCCTCTAACTCCTGGG - Intronic
1193502386 X:82295266-82295288 CACTGCAGCCTCGAACTCCAGGG + Intergenic
1193606990 X:83581141-83581163 CACAGGAGCTTCTGTCCCCATGG - Intergenic
1193667727 X:84343328-84343350 CACTGCAGCCTCAAACTCCAGGG + Intronic
1193778168 X:85669418-85669440 CACAGCAGCCTCTAATCCCTGGG - Intergenic
1194672043 X:96745973-96745995 CACAGCAGCCTCAAACTCCTCGG + Intronic
1195062072 X:101205901-101205923 CACTGCAGCCTCAAACCCCTGGG - Intergenic
1195533380 X:105982717-105982739 CACAGGAGACTTTAATCCTAGGG - Intergenic
1195793776 X:108621228-108621250 CACTGCAGCCTCAAACCCCTGGG + Intronic
1196176366 X:112643301-112643323 CACTGCAGCCTCTGACCCCCAGG - Intronic
1196554380 X:117070046-117070068 CATAGGAGACTGTAACCCTAGGG + Intergenic
1196785222 X:119415930-119415952 CACCGCAGCCTCTACCTCCAGGG - Intronic
1196823040 X:119718582-119718604 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1196842833 X:119874203-119874225 CACTGGAGCCTCAAACCCCTGGG - Intronic
1197211224 X:123829805-123829827 CACTGCAGCCTCTAACTCCTGGG + Intergenic
1197268346 X:124399894-124399916 CACTGCAGCCTCTAACTCCCGGG - Intronic
1197305152 X:124832648-124832670 CACAGCAGCCTCTACCTCCCGGG + Intronic
1197325677 X:125090577-125090599 CACTGCAGCCTCTAACTCCTGGG - Intergenic
1197505971 X:127305926-127305948 CAGTGGAGCCTGGAACCCCAGGG + Intergenic
1197556248 X:127958548-127958570 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1198372184 X:136000907-136000929 CACTGCAGCCTCAAACCCCTAGG - Intronic
1198569492 X:137939883-137939905 CACTGCAGCCTCAAACTCCAGGG - Intergenic
1198924496 X:141772388-141772410 CACTGCAGCCTCTACCTCCAAGG - Intergenic
1200113180 X:153754360-153754382 CACAGTAGCCTCGAACTCCAGGG - Intergenic
1200127423 X:153822752-153822774 CACAGAAGCCTCCAACTCCTGGG + Intronic
1200240775 X:154492258-154492280 CACTGCAGCCTCGAACCCCTGGG + Intergenic
1201228959 Y:11845190-11845212 CATAGGAGACTTTAACCCTAGGG + Intergenic
1201672028 Y:16533582-16533604 AACAGGAGTCCCTTACCCCAAGG - Intergenic