ID: 916445942

View in Genome Browser
Species Human (GRCh38)
Location 1:164871770-164871792
Sequence CCTTCCAACTCCGAGGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916445942_916445948 -1 Left 916445942 1:164871770-164871792 CCCCAAACCTCGGAGTTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 115
Right 916445948 1:164871792-164871814 GAAACTGCTCTCAGGAAGAATGG 0: 1
1: 0
2: 2
3: 23
4: 305
916445942_916445947 -9 Left 916445942 1:164871770-164871792 CCCCAAACCTCGGAGTTGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 115
Right 916445947 1:164871784-164871806 GTTGGAAGGAAACTGCTCTCAGG 0: 1
1: 0
2: 0
3: 12
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916445942 Original CRISPR CCTTCCAACTCCGAGGTTTG GGG (reversed) Intronic
901696435 1:11011570-11011592 ACTTCCAACTCCTAGGTTCAAGG - Intergenic
902668794 1:17957737-17957759 CCTTCCAGCTCTGAAGTTGGAGG + Intergenic
902702676 1:18183279-18183301 CCATCTAGCTCTGAGGTTTGGGG + Intronic
904377347 1:30090198-30090220 CCACACAACTCCGAGGTTTCTGG + Intergenic
906526548 1:46496579-46496601 CCTTCCAACTCTGAGCTTTTGGG - Intergenic
908769138 1:67580685-67580707 CCTTCCCAGTCAGAAGTTTGAGG + Intergenic
910701780 1:90083012-90083034 CCTGCCAAAACCCAGGTTTGGGG - Intergenic
911434875 1:97844700-97844722 CCTGCCAACTCAGAAGTGTGTGG - Intronic
915514097 1:156402610-156402632 CCCTCCAAATCCCAGTTTTGGGG + Intergenic
916445942 1:164871770-164871792 CCTTCCAACTCCGAGGTTTGGGG - Intronic
921625272 1:217372669-217372691 CCTGCCAACTCAGAAGTTGGTGG - Intergenic
922762762 1:228142738-228142760 ACTTCCAACTCCCAGGAATGGGG - Intronic
1065791216 10:29262583-29262605 CCTTCCAACTCTGTGGTTACAGG + Intergenic
1067695506 10:48532423-48532445 CCTTCCAATTCCAATGTCTGTGG - Intronic
1071046404 10:81384681-81384703 CCTTGCTACTCCGAAGGTTGAGG + Intergenic
1071142234 10:82522423-82522445 CCTTCTAAGTACGTGGTTTGTGG + Intronic
1075260692 10:120961815-120961837 CCTTCCAAATCTGAGGAATGAGG - Intergenic
1076277775 10:129218917-129218939 CTTTTCAACTCTGAGATTTGGGG + Intergenic
1076352409 10:129826113-129826135 CCTTCCCACTCCAAGGTGTGTGG + Intergenic
1076381907 10:130029150-130029172 CCTTCACACTCCGTGGCTTGCGG + Intergenic
1076738506 10:132469192-132469214 CCTTCCCGCTCCGGGTTTTGGGG - Intergenic
1083444015 11:62695198-62695220 CCTTCCTACTCTGAGTCTTGGGG - Intronic
1084292496 11:68183438-68183460 ACTTCCACCTCCCAGGTTCGAGG + Intronic
1085251615 11:75147753-75147775 CCTTCCACCTCCGACTTCTGAGG + Intronic
1087385099 11:97461243-97461265 CCTTCCAACTCAGAAGGTGGTGG - Intergenic
1089760259 11:120717795-120717817 CCTTCCAGCTCTGGGCTTTGTGG + Intronic
1091654710 12:2337164-2337186 CCTTCCAAGACCAAGGTTTTGGG + Intronic
1092032380 12:5298000-5298022 ACCTCCACCTCCCAGGTTTGAGG - Intergenic
1099355359 12:81628457-81628479 ACCTCCAACTCCCAGGTTTAAGG + Intronic
1100992641 12:100267234-100267256 CCTTCTAGCTCCGACGTTTGCGG + Intronic
1101884866 12:108653839-108653861 CCTTCCAAGTCCATGGTGTGTGG + Intronic
1103279854 12:119748230-119748252 CCACCCAACTCCTAGGTTAGTGG - Intronic
1103504155 12:121429912-121429934 CCTTGCAACACCGAGGTTTTGGG - Exonic
1108573095 13:51769286-51769308 CCTTCCTTCTCCCAGGTGTGAGG - Exonic
1109656552 13:65398825-65398847 CCATTCAAGTCAGAGGTTTGTGG + Intergenic
1110475660 13:75910464-75910486 CCTGCTAAGTCAGAGGTTTGGGG - Intergenic
1113733465 13:112658442-112658464 CTTTCAAACTCAGAGTTTTGAGG - Intronic
1115739820 14:36376362-36376384 CCTCCCTACTCCCTGGTTTGTGG - Intergenic
1126316866 15:47379253-47379275 CCTTTCAAATCCCAGTTTTGAGG - Intronic
1126807008 15:52361030-52361052 CCTTCCAACACCCAGGCTTATGG + Intronic
1128811589 15:70577008-70577030 CCTTCCAACTCTGAGACTCGAGG - Intergenic
1131345935 15:91648047-91648069 CTTTCCAACTCAGAGGTTCTAGG + Intergenic
1132827234 16:1911447-1911469 CCCTCCAACCTCGAGGTTTGTGG + Exonic
1132940719 16:2506749-2506771 ACTTCCAACTTCCAGGTTTGAGG + Intronic
1134219778 16:12344807-12344829 CCTTCTAACTCCCAGGTCTTGGG + Intronic
1134383201 16:13747457-13747479 ACTTCCACCTCCCAGGTTCGAGG - Intergenic
1137478946 16:48835138-48835160 TCTTCCATCTCTGAGATTTGAGG - Intergenic
1139025830 16:62816647-62816669 ACCTCCAACTCCCAGGTTTAAGG + Intergenic
1141724316 16:85776547-85776569 CCTGCCAACTCTCAGGTATGTGG - Intronic
1149560369 17:57604118-57604140 CCTTCCACTTCCCAGCTTTGTGG + Intronic
1151161258 17:72167688-72167710 CCTTTCCACTCCAAGGTTTAAGG + Intergenic
1153235849 18:2986701-2986723 CCTTCCAACACAAATGTTTGAGG + Intronic
1155446525 18:25918667-25918689 CCCTCCAACTCCCAGGTTCAAGG + Intergenic
1156748644 18:40423155-40423177 CCTTCCAACTCCCAGGATTTTGG + Intergenic
1158236196 18:55317513-55317535 CCAACCAACTGTGAGGTTTGGGG + Intronic
1159249875 18:65861432-65861454 CCTACCAACTCCGATGTCAGAGG - Intronic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162094346 19:8301881-8301903 CCTTCCCATTCCCAGGTCTGGGG - Intronic
1165204686 19:34173055-34173077 TCTTCCAACTCCGAAATTCGGGG + Intronic
1166036656 19:40173152-40173174 CTTTCCAACTCTGAGGACTGTGG + Intergenic
1168722248 19:58560553-58560575 TCTGCCAACCCCCAGGTTTGTGG - Intergenic
926372804 2:12197405-12197427 GCTTCCAGCTTCCAGGTTTGTGG - Intergenic
926787366 2:16531367-16531389 CCTTCCAGCTCCGAGAGTTTAGG + Intergenic
927131515 2:20064352-20064374 ACTTCCAGGTCTGAGGTTTGAGG + Intergenic
932308100 2:70718134-70718156 CCTACCAACTATTAGGTTTGAGG - Intronic
937487700 2:122332943-122332965 CCTTCCAATTCCTAGCTGTGTGG - Intergenic
938042934 2:128091080-128091102 CCTCTCATCTCCGAGGGTTGGGG - Intergenic
940864781 2:158807206-158807228 TTTTCCAACCCAGAGGTTTGAGG + Intronic
942221514 2:173773528-173773550 CACTCCAACTCCAAGGTTCGGGG - Intergenic
945574953 2:211518998-211519020 CCTTCCAACTTCCAGTTGTGAGG + Intronic
948291707 2:236830187-236830209 TCTTCCAACCCCAAGGGTTGGGG - Intergenic
1173106637 20:40143303-40143325 CCTTCCAACTTTAAGGTTTTTGG - Intergenic
1173340440 20:42148348-42148370 CCTTCCAAATCTGACTTTTGAGG - Intronic
1175812145 20:61864187-61864209 CCTTCCAGCTCCTGGGGTTGGGG - Intronic
1178718243 21:34986306-34986328 CCTTTCAACTTTCAGGTTTGAGG - Intronic
1183094866 22:35545987-35546009 CCTCCCAACTCCAAGGGTTATGG - Intronic
1183650181 22:39149137-39149159 CCTCCCAACTCCGAGATGGGAGG + Intronic
1184374987 22:44106172-44106194 CCTGCCATCTCACAGGTTTGGGG - Intronic
968713257 4:2136218-2136240 GCTTCCATCTCCGTAGTTTGGGG - Intronic
972784079 4:42310984-42311006 CCTTCCTACTCCTAGGGCTGGGG + Intergenic
976422703 4:84864717-84864739 CCTTCCAACTCCCAGTTAAGTGG + Intronic
981220254 4:142223675-142223697 CCTACCAACTCCTAGTATTGAGG - Intronic
982633748 4:157866040-157866062 CCTTCTTACTCTGAGGTCTGAGG - Intergenic
982714198 4:158789801-158789823 TTTTCCAACTCCAAGGGTTGTGG + Intronic
983456921 4:167976607-167976629 ACCTCCACCTCCCAGGTTTGAGG - Intergenic
985301643 4:188496385-188496407 CCTCCCAGCTCTGAGCTTTGGGG + Intergenic
988884367 5:35539484-35539506 CCTTCCCACTCTAAGGATTGAGG + Intergenic
991580558 5:68150914-68150936 ACCTCCAACTCCTAGGTTCGAGG + Intergenic
997353557 5:133247985-133248007 CCTTCCAACTCTGAGACTTGTGG - Intronic
998453671 5:142253874-142253896 CCTTCCTTCTCCGAGGAGTGAGG - Intergenic
999448986 5:151664491-151664513 CCTTCCAGCTCTAAGGTTTCAGG + Intronic
1007386284 6:41522381-41522403 CCTTCCAGCTTTGAGATTTGGGG + Intergenic
1011445566 6:87435740-87435762 CCTTCCAACTCCTGGGTTCAAGG + Intronic
1012305530 6:97652522-97652544 GCTTCCAACTCCAAGCTTAGTGG - Intergenic
1013099253 6:106974071-106974093 CAATCCAACTCCGAGGGTGGAGG + Intronic
1016363837 6:143294863-143294885 AATTCCAACACTGAGGTTTGGGG - Intronic
1017831042 6:158128775-158128797 TCTTCCAACTTCTAAGTTTGAGG - Intronic
1020073088 7:5240315-5240337 CCTCCCAACCCCGAGCTCTGAGG + Intergenic
1021834750 7:24658854-24658876 CCTTCCAACTTCTAGGTTCAAGG + Intronic
1022950975 7:35337563-35337585 CCCTCCAACTCCCTGGTGTGTGG - Intergenic
1027681865 7:81232471-81232493 CCTTGCATCTCCGAGCTTTGAGG - Intergenic
1028368900 7:90068668-90068690 CCTTCCAACTCCAAGGTGTAGGG + Intergenic
1035252218 7:157604954-157604976 CCTCCCAACTCCCTGGTGTGTGG + Intronic
1035646235 8:1223055-1223077 CCTGCCAGCTCAGAGGTCTGTGG + Intergenic
1038482954 8:27914365-27914387 CCTTCTAGCTCTGAGATTTGGGG - Intronic
1044921276 8:97172101-97172123 CACTCCAACTCCTTGGTTTGTGG - Intergenic
1045992424 8:108324599-108324621 CTTTCCTACTCCCAGGTTAGTGG - Intronic
1049346636 8:142142712-142142734 CCTTCCAAGACCCAGGGTTGGGG + Intergenic
1050788490 9:9435426-9435448 GCTTCCAACTCCTGGGTTCGAGG - Intronic
1052772499 9:32702747-32702769 CTTTCCAAATCTGAGTTTTGAGG - Intergenic
1052966757 9:34346201-34346223 CCTTCCAACTTTGATGTATGAGG - Intergenic
1055567944 9:77587870-77587892 CCCTCCAACCCCTAGGTTTTAGG - Intronic
1055999666 9:82201713-82201735 ACTTCCACCTCCCAGGTTTAAGG + Intergenic
1057050965 9:91923968-91923990 CCTTCCTATTCCAGGGTTTGAGG + Intronic
1057847736 9:98538545-98538567 CCTTGAAACTCAGAGGTTGGAGG + Intronic
1059590858 9:115659964-115659986 CCTTTCAACTCTGACATTTGGGG + Intergenic
1060543053 9:124444448-124444470 GCCTCCAACTCCAAGTTTTGTGG + Intergenic
1060942110 9:127548786-127548808 CTGTCCAACTCTAAGGTTTGGGG - Intronic
1061382244 9:130265600-130265622 CCGTCCAGATCCGAGGTTAGGGG - Intergenic
1186003401 X:5040463-5040485 CCTACCAACTCAGATATTTGAGG - Intergenic
1192343802 X:70284746-70284768 TCTTCCAATTCCTAGGCTTGGGG + Exonic
1194374746 X:93118260-93118282 CCTTCCAACTTTTAGGTTTAGGG - Intergenic
1194378290 X:93163222-93163244 CCTTGCAATTCTGAGTTTTGGGG - Intergenic
1200985035 Y:9295078-9295100 CCTTTCAACTCTGAGGTCTTAGG - Intergenic
1201852534 Y:18502407-18502429 GCTTCCAACTCCCAGGTTCAAGG + Intergenic
1201880787 Y:18817977-18817999 GCTTCCAACTCCCAGGTTCAAGG - Intronic