ID: 916446870

View in Genome Browser
Species Human (GRCh38)
Location 1:164880741-164880763
Sequence TAGTGTGTCTAGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916446860_916446870 -6 Left 916446860 1:164880724-164880746 CCCCCTCCCAAGCCCTCTAGTGT 0: 1
1: 0
2: 2
3: 46
4: 189
Right 916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG 0: 1
1: 0
2: 0
3: 24
4: 195
916446862_916446870 -8 Left 916446862 1:164880726-164880748 CCCTCCCAAGCCCTCTAGTGTGT 0: 1
1: 0
2: 2
3: 8
4: 158
Right 916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG 0: 1
1: 0
2: 0
3: 24
4: 195
916446859_916446870 12 Left 916446859 1:164880706-164880728 CCACTGTCACTCTTGCTGCCCCC 0: 1
1: 1
2: 1
3: 59
4: 468
Right 916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG 0: 1
1: 0
2: 0
3: 24
4: 195
916446863_916446870 -9 Left 916446863 1:164880727-164880749 CCTCCCAAGCCCTCTAGTGTGTC 0: 1
1: 0
2: 0
3: 14
4: 103
Right 916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG 0: 1
1: 0
2: 0
3: 24
4: 195
916446861_916446870 -7 Left 916446861 1:164880725-164880747 CCCCTCCCAAGCCCTCTAGTGTG 0: 1
1: 0
2: 1
3: 17
4: 179
Right 916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG 0: 1
1: 0
2: 0
3: 24
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916446870 Original CRISPR TAGTGTGTCTAGAGGGAAGT AGG Intronic
901598279 1:10402195-10402217 TAATGTGTCTAGAAGAGAGTGGG - Intronic
903274893 1:22214981-22215003 TAGTGAGTATATGGGGAAGTAGG + Intergenic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
905002657 1:34685235-34685257 TAGAGTGTATAGAAGGCAGTTGG - Intergenic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908403137 1:63789520-63789542 TATGGTATCTAGAAGGAAGTTGG + Intronic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
911553619 1:99315481-99315503 TAATGTGTCCAGATGGCAGTAGG + Intergenic
916399660 1:164432987-164433009 TACTGTGTTTAGATGGAGGTAGG - Intergenic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
919417983 1:197335175-197335197 TAGTGTGACTGGAGTGAAGGAGG + Intronic
920763954 1:208812961-208812983 TAGTGTGTCTAGTTGAAAGCTGG - Intergenic
921291501 1:213662114-213662136 AAGTGTGTCTCGAGGGGAGTGGG - Intergenic
922630269 1:227100284-227100306 TACTGTGTGGAGAGTGAAGTGGG - Intronic
923933214 1:238727083-238727105 TAGTGGGTCAAGAGGGGAGCTGG - Intergenic
924220788 1:241873289-241873311 CATTGAGTCTAGAGGGAAGCAGG + Intronic
1065125095 10:22566460-22566482 GAGTGTGCGTAGAGGGAAGGGGG - Intronic
1065178808 10:23104731-23104753 TACCGTGTCAAGAGGGAAGATGG - Intronic
1065270055 10:24020257-24020279 TAGTTTTACAAGAGGGAAGTTGG + Intronic
1065707765 10:28486889-28486911 TAGTCTGACTAGAATGAAGTAGG - Intergenic
1067383395 10:45796102-45796124 AAGTTTGTTTAGAGGGATGTTGG - Intergenic
1067524915 10:47032400-47032422 TGGGGTGTCTTGGGGGAAGTTGG + Intergenic
1067880773 10:50042691-50042713 AAGTTTGTTTAGAGGGATGTTGG + Intergenic
1067891101 10:50136669-50136691 AAGTTTGTTTAGAGGGATGTTGG - Intergenic
1070058781 10:72960882-72960904 TAGTGGGCATAGGGGGAAGTGGG - Intergenic
1070939263 10:80328915-80328937 TACTGTGGCTGGAGGGAAGGAGG - Intergenic
1076940394 10:133602778-133602800 TAGTGTGGCTAGAACAAAGTAGG + Intergenic
1077604195 11:3596478-3596500 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1080454871 11:32409021-32409043 TACTGTGGCTACAGGGAAATTGG - Intronic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1081307390 11:41530233-41530255 GAGTGTTTCAAGAAGGAAGTAGG + Intergenic
1081999436 11:47385521-47385543 TGTTATTTCTAGAGGGAAGTAGG - Intergenic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1084226645 11:67719290-67719312 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084260093 11:67971072-67971094 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1084808544 11:71597562-71597584 TGGTGAGACTAAAGGGAAGTAGG + Intronic
1084812679 11:71624182-71624204 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1084845653 11:71897568-71897590 TGGTGAGACTAGAGAGAAGTAGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1086443860 11:86853862-86853884 TGGTGAAACTAGAGGGAAGTAGG - Intronic
1089190143 11:116647833-116647855 TAGTGTGTGCAGAGGGAAAACGG + Intergenic
1090743910 11:129691926-129691948 TAGTGGGTTTTGAGGGAACTGGG - Intergenic
1091176160 11:133559850-133559872 TAGTGTGTTCACAGGTAAGTAGG + Intergenic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1092182017 12:6452476-6452498 TAGTGTGTGTGGAGGGAGGGTGG + Intronic
1092198959 12:6568186-6568208 TGGTGGGTCTAGAGGAAATTGGG - Exonic
1092431346 12:8411621-8411643 TGGCGAGACTAGAGGGAAGTAGG - Intergenic
1092434299 12:8434238-8434260 TGGCGAGACTAGAGGGAAGTAGG - Intergenic
1092676048 12:10921940-10921962 TATTGTTTGTAGAGGGCAGTGGG + Intronic
1094382583 12:29859021-29859043 TACAGTGTCTGGAAGGAAGTAGG + Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098508086 12:71278364-71278386 CAGTGTGTTTAGGGGGAAATGGG - Intronic
1100051603 12:90456005-90456027 TAATGTGTATAGAGGAAAGATGG + Intergenic
1101369998 12:104118485-104118507 TAGTTTGCCTAAAAGGAAGTTGG - Exonic
1101607024 12:106255002-106255024 TAGTGTGGCTAGATGAAAGCGGG - Intronic
1101998718 12:109543441-109543463 GAGAGTGTCTAGAGTGAAGGAGG + Intergenic
1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG + Intronic
1103752416 12:123174300-123174322 GAGTGTGTTTAGTGAGAAGTAGG - Intronic
1107546322 13:41436805-41436827 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1107628104 13:42311290-42311312 TAGTGTTTCAAGAGTGAAGTAGG + Intronic
1108317816 13:49255083-49255105 TAGAGTGTCTGAAGGGAATTTGG - Intronic
1109839770 13:67906374-67906396 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1111714231 13:91859049-91859071 TAGTGTGGCTAAAGGTTAGTAGG + Intronic
1112131616 13:96530835-96530857 TTGTGTCTCAAGAGGGTAGTGGG - Intronic
1112450259 13:99501552-99501574 TAGGGGGTCAAGAGGGAAGGAGG - Exonic
1114193507 14:20458321-20458343 TGCTGTGTCTAGGGTGAAGTAGG - Exonic
1118103387 14:62630456-62630478 TAATGGGTCTAGAAGGAATTGGG + Intergenic
1121169270 14:91839473-91839495 GAATGCATCTAGAGGGAAGTGGG - Intronic
1123805247 15:23864580-23864602 AAGTGTGTGTGGAGGGTAGTGGG - Intergenic
1124881341 15:33645712-33645734 TTGTGTGTGGAGAGGGAAATGGG - Intronic
1125594984 15:40879108-40879130 ATGTGTGTCTAGCTGGAAGTTGG - Intergenic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1128691435 15:69727322-69727344 TGCTGTGTCTCCAGGGAAGTGGG - Intergenic
1129919535 15:79308715-79308737 CAGTGTGTTTAGTGGGAAGCTGG + Intergenic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1133101439 16:3482521-3482543 TTGTGTGTCAACAGAGAAGTTGG - Exonic
1135850490 16:25958857-25958879 TTTTGTGCCTTGAGGGAAGTCGG - Intronic
1137458987 16:48640664-48640686 TAGTGTTTCTTGACTGAAGTTGG - Intergenic
1140786068 16:78343325-78343347 TAATGTGCCTAGAAGCAAGTAGG - Intronic
1140792944 16:78409843-78409865 GATTGTGGCTAGAGGGAAATGGG - Intronic
1143420357 17:6786357-6786379 TAGGGGGTGCAGAGGGAAGTGGG + Intronic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1147628307 17:41914173-41914195 TAGTTTGCCTAGAGGGAATGGGG - Intronic
1149180276 17:53928079-53928101 TAGTGGGTTGAGGGGGAAGTGGG - Intergenic
1149689055 17:58558465-58558487 TAGTGGGGCTAGAGAGAATTTGG - Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1154393816 18:13968930-13968952 ATGACTGTCTAGAGGGAAGTGGG - Intergenic
1155064908 18:22260253-22260275 TAATGTCTCTAGTGGGAAGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156164649 18:34403627-34403649 TAGTGACTCTTGAGGGAAGAAGG - Intergenic
1158849641 18:61482525-61482547 TAGTGTTTCTGGAGAGAAGGTGG - Intronic
1160901018 19:1428772-1428794 GGGTGTGTCTAAAGGGAAGGGGG + Intronic
1164774491 19:30842373-30842395 TACTGTGTTTACAGGGAGGTCGG - Intergenic
1165490869 19:36121895-36121917 GAGTGTTTGTGGAGGGAAGTGGG + Intronic
1165807202 19:38587691-38587713 TAGTGTGTCTATGGGGGAGGGGG + Exonic
1165921906 19:39304296-39304318 CAGTGTGTCTGGACTGAAGTGGG - Intergenic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166199002 19:41224196-41224218 AAGTGTGCCTGGAGGGTAGTGGG + Intronic
925227678 2:2199827-2199849 TACTGTGTGTAGTGGGAAGCAGG - Intronic
926443979 2:12921559-12921581 TAGTGTGACTTGAAGGATGTGGG + Intergenic
929862313 2:45689947-45689969 TAGTCTCTAGAGAGGGAAGTGGG - Intronic
932348257 2:71010210-71010232 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
932351134 2:71033090-71033112 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
932801896 2:74748250-74748272 GTGTGTGTCTAGAGGGATGGGGG - Intergenic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
940583945 2:155619157-155619179 TAGTGTGACAAGAGGGAATCAGG + Intergenic
940870677 2:158857732-158857754 TGGTGAAACTAGAGGGAAGTAGG + Intronic
942522189 2:176816334-176816356 TAGTGTGGCTTCTGGGAAGTTGG - Intergenic
943668134 2:190632146-190632168 TGCTAGGTCTAGAGGGAAGTGGG + Intergenic
945805372 2:214483959-214483981 TAGAGTTTCTGGAGGGAAGATGG - Intronic
946159093 2:217825314-217825336 GAGTGTGGCTAGAGGGAGGTGGG - Intronic
947219511 2:227779111-227779133 ACGTGTGTCAAGAGAGAAGTAGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948969958 2:241417839-241417861 TTGTGTGTTTAGAGGGCAGATGG - Intronic
1170084301 20:12511950-12511972 TAATGAGCCTAGCGGGAAGTTGG - Intergenic
1170196532 20:13694643-13694665 CAGTGTGACTAGAGGGACTTGGG - Intergenic
1170614643 20:17938875-17938897 TGATGTGTCTGGAAGGAAGTTGG - Intergenic
1171097628 20:22347027-22347049 TTGTCTGTCCAGAGGGAAATAGG - Intergenic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1175948378 20:62569354-62569376 TAGTGTGTGTGGTGGGAGGTGGG - Intronic
1178443354 21:32616503-32616525 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1179031537 21:37724555-37724577 TAGTGAGTGTGGAGGGGAGTGGG + Intronic
1180836156 22:18930517-18930539 CAGTGAGTGTAGAGGGCAGTTGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1203286248 22_KI270734v1_random:155816-155838 CAGTGAGTGTAGAGGGCAGTTGG + Intergenic
949885736 3:8692312-8692334 TGGTGAAACTAGAGGGAAGTAGG + Intronic
951739397 3:25903817-25903839 TAATATGTCTAGAGGGAGTTAGG - Intergenic
953073906 3:39550453-39550475 AAGTGAGTCTAGAAGGAATTGGG - Intergenic
953912263 3:46899093-46899115 TAGAGTGGCTAGAGGGTACTGGG - Intronic
957043250 3:75353338-75353360 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
957800536 3:85074152-85074174 TAATGTGGCTGGAGAGAAGTGGG - Intronic
958572598 3:95906993-95907015 TACTGTATCCACAGGGAAGTTGG - Intergenic
959717986 3:109454440-109454462 GGGTGTGTGTAGGGGGAAGTGGG + Intergenic
961273397 3:125707512-125707534 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
961276154 3:125728657-125728679 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
961875335 3:130018383-130018405 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
965382509 3:168007313-168007335 TAGTGAGTATGGAGAGAAGTGGG + Intergenic
967642594 3:191883832-191883854 TAGTTTGTGTAGAGAGAAGAGGG + Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968917502 4:3503003-3503025 TGGTGTGGCTCGAGGGCAGTGGG - Intergenic
969023329 4:4153312-4153334 TGGTGAGACTAGAGGGAGGTAGG - Intergenic
969026793 4:4179635-4179657 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
969735349 4:8985569-8985591 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
969786654 4:9463400-9463422 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
969912407 4:10458112-10458134 AGGTGTATCTAGAGGGCAGTTGG - Intergenic
970434303 4:16018597-16018619 AAGTGTGTCTAAAGGGACTTGGG + Intronic
972204615 4:36757362-36757384 TGGTGTGTCTGGAGAGAAGGAGG - Intergenic
975660000 4:76679270-76679292 TAGCGTGCCTGGAGGGCAGTGGG - Intronic
976771132 4:88653635-88653657 TAGTGGGTCAAGGGGGAAGCTGG + Intronic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
980459554 4:133090021-133090043 TTGTGTGTCTACATAGAAGTTGG + Intergenic
984258143 4:177411516-177411538 TAGTGTGGCTAGAGACAAGAAGG - Intergenic
984394899 4:179184925-179184947 TAGTATTTCTAGAAGGATGTTGG - Intergenic
988222006 5:28358749-28358771 TAGTGTGTCTCCAGGGAACATGG + Intergenic
988244217 5:28657466-28657488 TAGTGTGTCTAGAAATTAGTGGG - Intergenic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
993133023 5:83923217-83923239 TAGAGTGTCTGGAGAGAAGGAGG - Intergenic
993272627 5:85814744-85814766 GAGTGTGCCTAGTGGAAAGTAGG - Intergenic
993536376 5:89091886-89091908 TAATGTGTCTACAGGTCAGTTGG + Intergenic
993586255 5:89733069-89733091 TAGTGTGTATAAAATGAAGTGGG + Intergenic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
994952783 5:106486127-106486149 TAGTGCGTGTATAGGGAGGTGGG - Intergenic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
997833406 5:137172566-137172588 TAGTGTCTCTGGTGGGAAGGTGG - Intronic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1001220645 5:169897558-169897580 TACTGTATCAAGTGGGAAGTAGG + Intronic
1001966846 5:175915818-175915840 TAGTGTGTCTGCACGGAAGCAGG + Intergenic
1007423261 6:41732395-41732417 TTGTGTGTTTAGAGTGAGGTGGG - Intronic
1007497392 6:42269405-42269427 CCGTGTATCTTGAGGGAAGTGGG + Exonic
1007894988 6:45345878-45345900 TACTGTGTCTAGAGAGAAACTGG - Intronic
1008718435 6:54318487-54318509 TAGTGAGGATAGAGAGAAGTAGG - Intronic
1016542052 6:145177587-145177609 TAGTGGGGGTAGAGGGAGGTGGG + Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1020310437 7:6863496-6863518 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1029077140 7:97943825-97943847 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031934218 7:127719291-127719313 TAGTGTGTTTAGATGGTAATGGG + Intronic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG + Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1035915417 8:3615588-3615610 TAGTGTGTCTATATTGAAGTTGG - Intronic
1036240645 8:7078121-7078143 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036261410 8:7243457-7243479 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036305189 8:7596099-7596121 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036313450 8:7702001-7702023 TGGTGAGACTAGAGGGAAGTAGG - Intergenic
1036356039 8:8044095-8044117 TGGTGAGACTAGAGGGAAGTAGG + Intergenic
1036819134 8:11925370-11925392 TGGTGAGACGAGAGGGAAGTAGG - Intergenic
1036902516 8:12681228-12681250 TGGTGAGACTAGAGGGAAATAGG - Intergenic
1037055693 8:14438570-14438592 AAGTGTTCCTAGAGGGAATTAGG + Intronic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1038308132 8:26422776-26422798 TTGTGTGTGTAGAGGGGGGTGGG + Intronic
1038870783 8:31490329-31490351 TCCTGTGTCTAGTGGGAACTTGG + Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1044785724 8:95790345-95790367 TAGTGTTTCTAGAAGGTAATCGG - Intergenic
1048493666 8:134917625-134917647 TAGTGAATCCAGAGGGAAGGAGG - Intergenic
1049405146 8:142449069-142449091 TGGTGGGTGTAGATGGAAGTGGG - Intergenic
1051399851 9:16668994-16669016 TCGTGTGTCTTGAGGGGGGTGGG - Intronic
1054938660 9:70716001-70716023 TAGTGTGTCTCTAGGGATTTTGG + Intronic
1054940351 9:70733994-70734016 TAGTGTGTCTCTAGGGATTTTGG + Intronic
1056863739 9:90211397-90211419 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1056916169 9:90748047-90748069 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
1057027560 9:91746534-91746556 AAGTGTGTCTACACGGAATTCGG - Intronic
1057694018 9:97310951-97310973 CAGAGTGTCTAGAGGGAGCTGGG - Intronic
1058062361 9:100511069-100511091 TAGTGTGTATAGAAAGAATTTGG - Intronic
1059507976 9:114817221-114817243 TAGTGTGTGTAGTGGGGTGTAGG + Intergenic
1188264228 X:28050921-28050943 GAATGTGTTTAGAGGGGAGTCGG + Intergenic
1188460708 X:30423665-30423687 TAGTATGTGTATGGGGAAGTAGG + Intergenic
1192601311 X:72467440-72467462 TAGGGTGACGATAGGGAAGTTGG + Intronic
1195474147 X:105264837-105264859 CATTGTCTCTAGAGGGATGTTGG + Intronic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1197429026 X:126336685-126336707 TATTGTGTATAGTGGGAAGTGGG - Intergenic
1198211644 X:134521842-134521864 TAGTGTTTCTTGGGGGAGGTAGG + Intergenic