ID: 916448040

View in Genome Browser
Species Human (GRCh38)
Location 1:164891931-164891953
Sequence CAGCTCCTCCTGGGGGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 329}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916448034_916448040 6 Left 916448034 1:164891902-164891924 CCTGTTGATACCTGCAATATTTT 0: 1
1: 0
2: 0
3: 13
4: 185
Right 916448040 1:164891931-164891953 CAGCTCCTCCTGGGGGAAAAAGG 0: 1
1: 0
2: 5
3: 36
4: 329
916448035_916448040 -4 Left 916448035 1:164891912-164891934 CCTGCAATATTTTAAAAGTCAGC 0: 1
1: 0
2: 1
3: 24
4: 274
Right 916448040 1:164891931-164891953 CAGCTCCTCCTGGGGGAAAAAGG 0: 1
1: 0
2: 5
3: 36
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916448040 Original CRISPR CAGCTCCTCCTGGGGGAAAA AGG Intronic
900112490 1:1014380-1014402 CAGCTCCCGCTGGGGGAGTACGG + Exonic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
901198078 1:7451430-7451452 CAGCTCTGCCTGGGGGATGAGGG + Intronic
901435581 1:9245509-9245531 CATCTCCTCCTCCTGGAAAAAGG - Exonic
901460568 1:9388840-9388862 CAGCTTCTCCTGCTGTAAAAAGG - Intergenic
901534378 1:9872826-9872848 CAGCTCCTCCTGGAGGGAGGGGG - Intronic
901631709 1:10651294-10651316 CAGGGCCTCCTGGAGGAGAAGGG + Intronic
901961342 1:12828691-12828713 CAGCTCCTCCAGGGTGGAGACGG + Exonic
901967932 1:12883296-12883318 CAGCTCCTCCAGGGTGGACATGG + Exonic
901969468 1:12895755-12895777 CAGCTCATCCAGGGTGAAGATGG + Exonic
901975737 1:12942426-12942448 CAGCTCCTCCAGGGTGGACATGG + Exonic
901983331 1:13053561-13053583 CAGCTCCTCCAGGGTGGACATGG + Intronic
901985679 1:13073770-13073792 CAGCTCCTCCAGGGTGGACATGG - Exonic
901996130 1:13152997-13153019 CAGCTCCTCCAGGGTGGACATGG + Intergenic
901998757 1:13175357-13175379 CAGCTCCTCCAGGGTGGACATGG - Intergenic
902009437 1:13259339-13259361 CAGCTCCTCCAGGGTGGACATGG - Exonic
902015704 1:13306025-13306047 CAGCTCATCCAGGGTGAAGATGG - Intronic
902017243 1:13318484-13318506 CAGCTCCTCCAGGGTGGACATGG - Exonic
902030155 1:13416425-13416447 CAGCTCCTCCAGGGTGGAGATGG - Exonic
902387357 1:16083486-16083508 CAGCCCCTCCTGGGGCCAAGGGG - Intergenic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
903384944 1:22920161-22920183 CAGGCCTTCCTGGGGGTAAAAGG + Intergenic
903776425 1:25797003-25797025 CAGCGCCCCCTGCGGGAAGAAGG + Intergenic
904056284 1:27672509-27672531 CAGCTCCCCCTGGGGCACACAGG + Intergenic
904284699 1:29446509-29446531 CAGGTACTCCTGGGGGCAACGGG + Intergenic
904539907 1:31225813-31225835 CAGCTTCTCCTGGAGGAATGAGG - Intronic
905211063 1:36374452-36374474 CGGCTGCTCCTGGGAGCAAAGGG + Intronic
906836379 1:49086776-49086798 GAGTTCTTCCTGGGGGAATACGG - Intronic
910265201 1:85331060-85331082 CAGCTCCACCCTGGGGAACAAGG - Intronic
912472008 1:109912491-109912513 CAGATCCTCCTGAGGCAGAATGG + Intronic
912525681 1:110281024-110281046 CAGATCCTCCTGGGGGTATTAGG + Intronic
914456389 1:147841032-147841054 CAGCTCCTCCAGGGTGAAGATGG - Intergenic
916360242 1:163959769-163959791 CAGTTTCTGCAGGGGGAAAAGGG - Intergenic
916448040 1:164891931-164891953 CAGCTCCTCCTGGGGGAAAAAGG + Intronic
916570123 1:166017837-166017859 CAGTTTCTCCTGGAGTAAAATGG - Intergenic
917657193 1:177138103-177138125 CAACTCTCCCTAGGGGAAAAGGG + Intronic
917902803 1:179559892-179559914 CACCTCCACCTGAGGGTAAAAGG + Intronic
918407408 1:184224447-184224469 CAGCTCCTTCTGGGTAAAGAGGG - Intergenic
918458573 1:184753369-184753391 CAGCTCTTCCTTGGAGGAAATGG - Intronic
920451194 1:206062420-206062442 CTGCCCCTCCTGAGGCAAAAGGG + Intronic
920657831 1:207889434-207889456 CACCTCTGCCTGGGGGAACAGGG - Intronic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
922664044 1:227453923-227453945 CCACTCTTCCTGGGGGAAATGGG - Intergenic
1064568451 10:16668140-16668162 CAGCTTCTCCTTTGAGAAAATGG + Intronic
1067901672 10:50248118-50248140 CATTTTCTCCTGGGGGCAAAAGG - Intronic
1069897956 10:71690451-71690473 TGGCTCCTTCAGGGGGAAAAAGG - Intronic
1071971740 10:90915027-90915049 CAGCTACCCCTGGAAGAAAATGG + Intronic
1073063135 10:100744051-100744073 GAGCTCCTCCTGAGGAATAAGGG + Intronic
1073366939 10:102950944-102950966 TAGTTCCTCCTGGGGGCAATAGG + Intronic
1077662551 11:4082637-4082659 GAGGTCCTCCTGGGGCAAAAGGG + Intronic
1081659851 11:44881370-44881392 CAGCTGCTCCTGGAGGGAACTGG - Intronic
1081709699 11:45208909-45208931 CAGCTCCTCCTTGGAGAACTTGG - Intronic
1081805336 11:45886893-45886915 CAGCCCCTCCTGGGAGCAAGGGG + Intronic
1083213934 11:61206788-61206810 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083216818 11:61225617-61225639 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1083219700 11:61244443-61244465 CAGGTGCTCCAGGGGGTAAAGGG + Intronic
1084083307 11:66843155-66843177 CAGCACGTCCTGCGGGAACAAGG - Exonic
1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG + Intronic
1084671352 11:70608421-70608443 CAGCTCCTGATGGGGGATCATGG + Intronic
1085117714 11:73944993-73945015 CAGCTGATCCTGAGGGTAAAGGG + Intergenic
1085123195 11:73980537-73980559 GAGCACCTCCTGGGGGAAGGGGG - Intronic
1086244858 11:84740299-84740321 GAGGTCCTCCTGAGTGAAAAAGG + Intronic
1088274060 11:108065655-108065677 CAGCTGCTGCTGGGGGATGAGGG + Intronic
1088591519 11:111407842-111407864 CAGCCCCACCTGGGTGCAAATGG - Intronic
1088932836 11:114369371-114369393 CAGCTTCTCCTTGGGGAGCAGGG - Intergenic
1089032326 11:115345117-115345139 CAGCCCCTGCTGTGGGACAAAGG - Intronic
1090512034 11:127385618-127385640 CAGATCATTCTGGTGGAAAAGGG + Intergenic
1090891316 11:130925028-130925050 CACCTCCTCCTGCTGGAACAAGG - Intergenic
1092322136 12:7487500-7487522 GTGCTCCTCCTGGGGTAGAAAGG + Exonic
1092980389 12:13788839-13788861 CAGGTCTTCCTTGGAGAAAAAGG - Intronic
1097861427 12:64522338-64522360 CAGCTCCTGCTGGGGGGATGTGG + Intergenic
1098285821 12:68905896-68905918 CAGATCCTCCTGGGGAACACTGG + Intronic
1098809426 12:75067507-75067529 GAGTTCTTCCTGGGGGAATATGG + Intronic
1098907754 12:76179328-76179350 CAGATCCTCCTCTGTGAAAAAGG + Intergenic
1099163620 12:79275076-79275098 CTGCCACTCCTAGGGGAAAAGGG + Intronic
1100855328 12:98752655-98752677 CTGCTCCTCCTGGGGCTAACTGG - Intronic
1102181474 12:110915812-110915834 CAGCTCAGCCTGGGAGAAACTGG + Intronic
1102602142 12:114039450-114039472 AGGCTCCTCCTGGGGGACAGAGG + Intergenic
1103435993 12:120925827-120925849 CAACTCCTCCTGTGGGAAGGAGG - Intergenic
1103720759 12:122974180-122974202 CTGGGCCTCCTGGGGAAAAAGGG + Intronic
1104466340 12:128993877-128993899 CAGATCCTCCTGGGAGCAGATGG + Intergenic
1105223754 13:18408664-18408686 CAGCCTCTCCAGGGAGAAAATGG - Intergenic
1105519874 13:21122605-21122627 AAGCTCCTCTTGGTGGAAATGGG - Intergenic
1108342752 13:49514052-49514074 CAGCTCCTCATGGGTCATAAGGG + Intronic
1108500510 13:51065964-51065986 CAGCTGCTCCTGGGGCCACAGGG + Intergenic
1110866318 13:80399807-80399829 CAGCTCGTACTGGGGGAACCAGG - Intergenic
1113772464 13:112918848-112918870 CAGCTCCTGCACTGGGAAAATGG - Intronic
1114007909 14:18333511-18333533 CAGCCTCACCTGGGAGAAAAGGG - Intergenic
1114083250 14:19219495-19219517 CAGGTCCTCCTGGGGGAACTGGG + Intergenic
1115198625 14:30829217-30829239 CAGTTCCGCCTGGGCGAAAGAGG + Intergenic
1116508419 14:45714323-45714345 CAGCTCATACTGGGGGAACCAGG + Intergenic
1119026263 14:71155286-71155308 CAGCTCTTGCTGGATGAAAATGG + Intergenic
1119441437 14:74631276-74631298 CAAGACCTCCTGGGGGAAAGGGG + Intergenic
1119631099 14:76232898-76232920 CAGCCCCTCCAGAGGTAAAATGG + Intronic
1120463362 14:84825520-84825542 CAGGTCCGCCTTTGGGAAAATGG - Intergenic
1121467503 14:94125478-94125500 AAGTTCCTCCTTGGGGAACAGGG + Intergenic
1122393149 14:101404460-101404482 CATCTCCTCCCTGGGCAAAATGG + Intergenic
1122776588 14:104119558-104119580 CAGGTCCTCCGAGGGGATAAGGG - Intergenic
1122977092 14:105175203-105175225 CACCTCCTCCAGGGGGACCAAGG + Intronic
1202894872 14_GL000194v1_random:1265-1287 CAGGTCCTCCTGGGGGAGCTGGG + Intergenic
1123448554 15:20346198-20346220 CAGCTCTGCCTGGGGCAACAGGG - Intergenic
1127137857 15:55943465-55943487 CAGCTCCAGCTGTGGGTAAAAGG + Intronic
1127603298 15:60560769-60560791 CAGCTGCTGCTGGGAAAAAATGG - Intronic
1129520378 15:76182240-76182262 CAGCTTCTCATTGGGGAAATTGG + Intronic
1133560363 16:6944973-6944995 TTGCTCCTCCTGGGTGAAAAGGG + Intronic
1134029209 16:10978317-10978339 CAGTTCCTCCGGAGGTAAAAGGG + Intronic
1134822797 16:17260257-17260279 CAGCTCCTCCATGGGTAAATGGG + Intronic
1135082044 16:19444748-19444770 CAGAACCTACTGGGGGAAAAGGG + Intronic
1135354330 16:21757065-21757087 CAGCTCCTGCAGGAGGCAAAGGG - Exonic
1135395182 16:22125961-22125983 AAGCACCTCCTGGGAGAGAAGGG + Intronic
1135452821 16:22573205-22573227 CAGCTCCTGCAGGAGGCAAAGGG - Intergenic
1135930309 16:26730688-26730710 CAGCTTTTCCTGGGGGAATATGG - Intergenic
1136059674 16:27717937-27717959 CAGCTGCTCCTGTGGGCAACTGG - Intronic
1136293668 16:29290191-29290213 AAGCTCCTCCTGGAAGCAAAGGG - Intergenic
1136590797 16:31216598-31216620 CAGCCCCTCCCGGGGGCGAAGGG - Intronic
1136637957 16:31537640-31537662 CAGTTCCTCCTGCGGGAACTTGG - Intergenic
1136666772 16:31819513-31819535 CAGTTCCTCCTGCGGGAACTTGG + Intergenic
1137036517 16:35574036-35574058 CTGCCCCTCCTGGGGGAAGGCGG + Intergenic
1137403737 16:48174212-48174234 GAGCTCCTGCTGGGGGAGCAGGG + Intronic
1138025629 16:53520316-53520338 TAGCTCCTCCTGGGTGAAAGGGG + Intergenic
1138557991 16:57784113-57784135 AGGCTCTGCCTGGGGGAAAACGG - Intronic
1139558660 16:67728313-67728335 CAGCCCCTCCCAGGGGAAGAGGG + Intronic
1139559422 16:67732312-67732334 CAGCTTCTGCTGGGGTTAAATGG - Intronic
1139630403 16:68228388-68228410 CAGCTACACCAGGGGCAAAAGGG - Exonic
1140584821 16:76277175-76277197 CACCTCCAGCTGGGAGAAAAGGG + Intergenic
1140656861 16:77150108-77150130 GAGCACCTCCAGGGGGAAAAGGG + Intergenic
1141378116 16:83550301-83550323 CAGCGCCCCCTGGTTGAAAAAGG - Intronic
1141627647 16:85269707-85269729 CAGCTCCTCTTTGGGGACACTGG - Intergenic
1142099551 16:88264197-88264219 AAGCTCCTCCTGGAAGCAAAGGG - Intergenic
1142276226 16:89120297-89120319 CAGCCCCTCCTGGGGACATAGGG + Intronic
1142484696 17:239071-239093 CACCCCCTCCTGGGGAAAGAAGG + Intronic
1143274435 17:5699769-5699791 TATCACCTCCTGGGGGAAAAGGG + Intergenic
1144208763 17:12997429-12997451 CATTACCTTCTGGGGGAAAAAGG + Intronic
1144600462 17:16608367-16608389 CAGCTCTTCCTGGGGTCAACTGG - Intergenic
1145256184 17:21323708-21323730 CAACCCCTCCTGGGGGAACCTGG - Intergenic
1145880136 17:28347147-28347169 CAGCTCCCCCTGGAGGACTAAGG + Intergenic
1147566412 17:41538999-41539021 CTGCTCTTCCTTGGGGCAAAGGG - Intergenic
1148080057 17:44963023-44963045 CAGCTCCTCCTGGGGTCCAAGGG + Intronic
1148177126 17:45576450-45576472 CAGCCCCAACTGGGGGTAAAGGG + Intergenic
1149231863 17:54544377-54544399 CAGCTCCAGCAGGGGAAAAATGG - Intergenic
1150105426 17:62459290-62459312 CAGGTCCTCCTGGGGTGAAGGGG + Intronic
1150381270 17:64722038-64722060 AACCTCCTCCTAGGGGCAAATGG - Intergenic
1151977947 17:77492903-77492925 CAGCTCCTCCCGGGGGCCCAGGG + Intronic
1152307152 17:79527838-79527860 GAGGGCCTCCTGGGGCAAAAGGG + Intergenic
1152340236 17:79720391-79720413 CAGCTCTGCCTGGGGCAACAGGG + Intergenic
1153043066 18:832250-832272 CAGCTTCTCCTGGAGGTAATTGG - Intergenic
1153065228 18:1037980-1038002 CAGCTCCTCCCAGGGGACACTGG - Intergenic
1153949541 18:10046517-10046539 CAGCTCCTCCAGAGAGGAAAGGG - Intergenic
1154499944 18:14991170-14991192 CAGGTCCTCCTGGGGGAGCTGGG + Intergenic
1154529550 18:15330451-15330473 CAGCCTCTCCCGGGAGAAAATGG + Intergenic
1155272433 18:24153596-24153618 CAGCCCCTCCAGGGAGAAAAGGG - Intronic
1157056025 18:44229938-44229960 CAGCTCCTCCTGCAGGCAACAGG - Intergenic
1157597763 18:48874347-48874369 AAGCTCCTCCTGGGAGCACAAGG + Intergenic
1158751002 18:60260812-60260834 CAGCTTCTCCTGGAGATAAAAGG - Intergenic
1159004432 18:63000068-63000090 TTCCTCCTCCTGGGGGACAAGGG - Intergenic
1160197930 18:76772305-76772327 CAGCTTCTCCTGAGGGAAAAGGG - Intergenic
1160337712 18:78057431-78057453 CAGCTCCTCCTGGGAGGAGGAGG + Intergenic
1161042306 19:2116656-2116678 CTGCTCCTCCTCGTGGAAGACGG + Exonic
1161439009 19:4279979-4280001 CTCCTCCTCCTTGGGGAAAGGGG + Exonic
1162427039 19:10602953-10602975 CGGCTACTTCTGGCGGAAAAGGG - Intronic
1163923789 19:20319628-20319650 CAACTCTTCCTGAGGGTAAAGGG + Intergenic
1165040096 19:33062978-33063000 CAGCAGCACCTGGGGGAAAATGG - Intronic
1165979809 19:39711024-39711046 CAGCTCTTACAGTGGGAAAAGGG - Intergenic
1166155613 19:40909272-40909294 CAGCACTTCCTGGGTGAGAAGGG - Intergenic
1166853976 19:45773263-45773285 CAGTCCCTCCTGTGGGAACACGG + Intronic
1166975569 19:46603233-46603255 CAGGTTCTGCTGGGGGAAAATGG - Intronic
1167483489 19:49746790-49746812 CAGCTTCTCCTGGGTGGTAAGGG + Exonic
925018954 2:553648-553670 CACCTCCTCCTGGGTGGACAGGG - Intergenic
925018976 2:553709-553731 CACCTCCTCCTGGGGGCACAGGG - Intergenic
925018990 2:553740-553762 CACCTCCTCCTGGGGGCACAGGG - Intergenic
925283826 2:2703269-2703291 CTGCTCCTTTTGGGGCAAAAGGG - Intergenic
926148456 2:10411347-10411369 CAGCTCCACCTTAGGGACAAGGG - Intronic
926178064 2:10614859-10614881 CTGCATCTCCTGTGGGAAAATGG + Intronic
927756022 2:25708526-25708548 CAGCTTCCCTTGGGGGAAGAGGG + Intergenic
928454278 2:31405145-31405167 CAGTTCCTCCTCTGTGAAAAGGG + Intronic
929771647 2:44897397-44897419 CAGGTAATCCTGGGTGAAAAGGG + Intergenic
929862334 2:45690332-45690354 CTGCTTCTCTTGGGGGATAAAGG + Intronic
929931133 2:46256396-46256418 CAGCTCCTCGTAGGGGAGAGAGG + Intergenic
932213185 2:69948623-69948645 CAGCTCGCCCTGGAGGAAAGGGG + Intergenic
932648530 2:73530880-73530902 CAGCTCCACCTGTGGCTAAAAGG - Intronic
933671735 2:85014332-85014354 CATCTACTTCTGGGGAAAAAAGG + Intronic
933816135 2:86070075-86070097 CAGCTCACTCTGGGGGAAATGGG + Exonic
934640633 2:96025316-96025338 CTGCTCCTCCTGTAGGAGAAGGG + Intronic
935143972 2:100381358-100381380 CAGCGCCCCCTGGAGGAACATGG + Intergenic
936156133 2:110048460-110048482 CAGCTCCACCTTGGGGGAAGGGG + Intergenic
936188554 2:110322968-110322990 CAGCTCCACCTTGGGGGAAGGGG - Intergenic
937323917 2:120977731-120977753 AAGCTTATCCTGGGAGAAAACGG - Intronic
938294853 2:130171793-130171815 CAGCTGCTGCTGGGGCAAGAGGG + Intronic
940214722 2:151292710-151292732 CAGTTCATCCTTGGGGAAACTGG + Intergenic
942291980 2:174482344-174482366 GAGCTCCGCCTGGTGGATAAGGG + Intronic
943267680 2:185756097-185756119 CAGCTCCTCTTGGGCATAAAAGG + Intronic
943701598 2:190993894-190993916 TAGGTCCTGCTGGGGGAAAAGGG + Intronic
944866737 2:203870028-203870050 CAGCTACTCCTGGGTGACAGAGG + Intronic
945954269 2:216071081-216071103 CAGCTCATACTGGGGGAACCGGG + Intronic
946076707 2:217079601-217079623 TAGCTCCTCCTGAAGGAAAAAGG + Intergenic
946255764 2:218440786-218440808 TAGCTGCTCCAGGGGGAAGATGG - Exonic
947165139 2:227254109-227254131 CAGGACCTCAAGGGGGAAAAGGG + Exonic
948088549 2:235270908-235270930 CGCTTCCTCCTGGGAGAAAAAGG + Intergenic
948712865 2:239836186-239836208 CAGCTCCACCTCGGGGAGCACGG - Intergenic
948803763 2:240444252-240444274 TGGCTCCTCCTGAGGGACAAGGG + Intronic
1169189377 20:3648156-3648178 GAGCCCCTCCTGGGGGAAAGAGG - Exonic
1170898147 20:20435151-20435173 CAGGGCCTCCTTGAGGAAAAGGG - Intronic
1172029282 20:31970069-31970091 TAGCTTATCCTGGAGGAAAAGGG + Intronic
1172972429 20:38883237-38883259 CTGCTCCTCCTCTGGGGAAACGG - Intronic
1173909210 20:46651539-46651561 CTGCTCCTCCTGGAGGAAAAGGG + Intronic
1176295510 21:5069978-5070000 CACCTCGTCCTGAGGGAAGAAGG + Intergenic
1176516641 21:7789249-7789271 CAGGCCCACCTGGGGGCAAAGGG - Intergenic
1176614569 21:9017252-9017274 CAGGTCCTCCTGGGGGAGCTGGG + Intergenic
1176767856 21:13038042-13038064 CAGCCTCTCCAGGGAGAAAATGG - Intergenic
1177570610 21:22881407-22881429 CAGTTTGTACTGGGGGAAAAAGG - Intergenic
1177857230 21:26413191-26413213 CAGCTCTTGATGGAGGAAAATGG + Intergenic
1178650669 21:34419261-34419283 CAGGCCCACCTGGGGGCAAAGGG - Exonic
1179655028 21:42839542-42839564 CAGCTCCTCCTTGGAGGAAGTGG - Intergenic
1179861540 21:44192146-44192168 CACCTCGTCCTGAGGGAAGAAGG - Intergenic
1179986087 21:44920954-44920976 CAGCTCCTCCTTGGAGGAAGTGG + Exonic
1180294723 22:10873772-10873794 CAGGTCCTCCTGGGGGAACTGGG - Intergenic
1180432416 22:15264321-15264343 CAGCCTCACCTGGGAGAAAAGGG - Intergenic
1180497529 22:15903186-15903208 CAGGTCCTCCTGGGGGAACTGGG - Intergenic
1180514988 22:16132301-16132323 CAGCCTCTCCTGGGAGAAAAGGG - Intergenic
1180670964 22:17552729-17552751 AAGCTCCTCATGTGTGAAAATGG - Intronic
1181402798 22:22661483-22661505 CAGCTCCAACTCGGGGAACATGG + Intergenic
1181982496 22:26775432-26775454 AAGCTCCTCCTGTGAGACAATGG + Intergenic
1182148797 22:28014223-28014245 AAGCACCTCCTGGGGGCACAAGG - Intronic
1183398947 22:37589820-37589842 TTGCTCCTGCTGGGGGAACAAGG - Intergenic
1183599619 22:38832369-38832391 CAGCTCCTGCTGGGGCAGAAAGG + Intronic
1183664936 22:39241829-39241851 CACCTCCGCGTGGTGGAAAATGG - Intronic
1183896768 22:40975646-40975668 CAGCTTCTGCTTGGGCAAAAGGG + Intergenic
1184596216 22:45515796-45515818 CAGCTTCCCCAGTGGGAAAACGG - Intronic
1184681542 22:46074823-46074845 CAGACCCTCCTGGGTGAGAAGGG + Intronic
949175726 3:1060405-1060427 CAGCTCCTCCTGGTAGAATTTGG + Intergenic
949888611 3:8715267-8715289 CAGTTCCTCCTGGTGGAGAGGGG - Intronic
952671571 3:35974963-35974985 CTGCTCCACCTGTGGCAAAAAGG - Intergenic
953815612 3:46153855-46153877 CAGCCCCTCCTCTGGGAAGAAGG - Intergenic
954375353 3:50191619-50191641 CAGGTCCTCCTGGGGCCAGAAGG + Exonic
954378328 3:50206210-50206232 CAGGTCCCCGTGGGGGGAAAAGG - Intronic
954417098 3:50398626-50398648 CAGCACATCCTGGGGGGTAAGGG + Intronic
955155085 3:56408821-56408843 CTGCTGCTCCTGGGGGACAGCGG - Intronic
956208325 3:66776880-66776902 CTACTCCTCTTGGGGGAAAATGG - Intergenic
956942643 3:74181487-74181509 AAGCTCCTCCTGGGTGAAAATGG - Intergenic
960724751 3:120658890-120658912 CAGCTCCTCCTGTGGCTCAAAGG - Intronic
960997291 3:123348569-123348591 CAGTTCCACCTGGGGGACAGTGG + Intronic
961741000 3:129033093-129033115 CACCTCCCCCTGAGGGACAAGGG - Intronic
961818659 3:129564186-129564208 CGGCTCCTCCTGGGGGAAGGGGG - Intronic
962373572 3:134841091-134841113 CAGCTTCTCCTGGTGGAATAAGG - Intronic
963671592 3:148258387-148258409 CAGCTCCAGCTGTGGGTAAAAGG + Intergenic
967652663 3:192005969-192005991 TAGCTCCACCTGAGGGAGAAGGG - Intergenic
968607791 4:1543693-1543715 CAGCTCTTCTTGGGGGAAGTGGG - Intergenic
968757138 4:2422661-2422683 CAGCTCTGCCTGGAGGAACAGGG - Intronic
970406961 4:15773107-15773129 AAGCTCTTCCTGGGTGAGAAAGG + Intergenic
971470856 4:27024973-27024995 CTGCTGCTCCTGGGTGAGAAGGG + Intronic
972973431 4:44605069-44605091 CAGCTCTGCATGGAGGAAAAAGG + Intergenic
973789053 4:54361888-54361910 CAGCTTCTTCTGAGAGAAAATGG - Intergenic
974364345 4:60926961-60926983 CAGCTGCTTCTGGGGCAGAAAGG - Intergenic
976072759 4:81260613-81260635 CAGCTCCCCCTACTGGAAAAAGG + Intergenic
976137870 4:81958563-81958585 CAGCTACCCCTGGGGGAGATGGG + Intronic
976788117 4:88845685-88845707 CAGTTACCCCTGGGGGAGAAAGG + Intronic
981260050 4:142708528-142708550 CAGCTCCACCTGTGGCTAAAAGG + Intronic
981348157 4:143699530-143699552 CAGCTCCTGCTGGGTGAAGAAGG + Exonic
981579668 4:146238973-146238995 CAGTTCTTCCTGGGTGTAAAGGG + Intergenic
983166343 4:164481748-164481770 CTGCTCAGCTTGGGGGAAAAAGG + Intergenic
983485010 4:168322896-168322918 CACATCCTCCTGTGGGAAACAGG - Intergenic
983534697 4:168844966-168844988 CAGCTCTGCCTGGGGGAGTAAGG + Intronic
984372152 4:178882239-178882261 CAGCTCCTGCTGTGGCTAAAAGG + Intergenic
984860177 4:184230698-184230720 CACCTCCTCCTGGGGGCTAAGGG - Intergenic
987176881 5:15321079-15321101 CAGCTGCTCCTGGAGAATAATGG - Intergenic
987401880 5:17486423-17486445 CAGCTCCTCCTGCAGCCAAAAGG + Intergenic
988470280 5:31531604-31531626 CAGATCCACCTGGGGAAAGAGGG - Intronic
989519645 5:42386239-42386261 AATCTGCTCCTGGGAGAAAATGG - Intergenic
991355771 5:65767397-65767419 CAGCTCCAGCTGGGCTAAAAGGG - Intronic
993690696 5:90996322-90996344 CAGCTCCAGCTGTGGCAAAAAGG + Intronic
994096144 5:95849926-95849948 GAGCTTCTCCAGTGGGAAAAAGG + Intergenic
994220164 5:97186308-97186330 GAGCCCCTCTTGGGGGAACATGG - Intergenic
995353133 5:111205350-111205372 CAGCTCCTCCAGAGGGACCAAGG + Intergenic
995356298 5:111241574-111241596 TAGCTCACCCTTGGGGAAAAAGG + Intronic
997931711 5:138077988-138078010 GAGGTCCTCCTGTGTGAAAATGG - Intergenic
998199919 5:140111591-140111613 CAGCGCCTCCAGGGACAAAAAGG - Intronic
998291317 5:140917137-140917159 CAGCTGCTGCTGGGGGATATGGG + Intronic
998741277 5:145204971-145204993 AGGCTCCTCCTGGCTGAAAATGG - Intergenic
998974212 5:147626420-147626442 CTCCTCCTCCTGTGGGAAATAGG - Intronic
999805206 5:155074629-155074651 TAGCTCCACTTTGGGGAAAAAGG + Intergenic
1001099071 5:168799059-168799081 CAGCTCATCCACAGGGAAAATGG + Intronic
1001265251 5:170269397-170269419 CAGCTCTTCCACAGGGAAAAGGG + Intronic
1001287661 5:170435556-170435578 CTTCTCCTCCTGGGAGAGAATGG - Intronic
1001449644 5:171814728-171814750 CAGCTCCTCCTGGGTGAGCTGGG - Intergenic
1002433752 5:179219203-179219225 CTGCTGCTCCTGGGGGAAGGAGG - Intronic
1003054172 6:2804004-2804026 CAGCTCCTCCTGGGGCTACCTGG - Intergenic
1003298889 6:4858815-4858837 CAGTTCCTCCTCTGGAAAAAGGG + Intronic
1005802953 6:29445597-29445619 CAGCTCCTCCTGTGGCAGCATGG + Intronic
1006400968 6:33817131-33817153 CCGCTCAGCCTGGGGGAAACTGG + Intergenic
1006471127 6:34229384-34229406 CAGCTGGTCCTGGGTGGAAAGGG + Intergenic
1007071879 6:39043891-39043913 CAGCAAGTCCTGGGGGCAAAGGG - Intergenic
1007235060 6:40384853-40384875 CAGTTCCTCCTGAGAGAAAGAGG - Intergenic
1007478342 6:42133999-42134021 CAGGTTCTCCTGAGGGAGAAGGG - Intronic
1008059226 6:46979416-46979438 CAGCCCCTCCGGGGGTAGAAAGG + Intergenic
1010769371 6:79811110-79811132 CAGCTACTCCTGTGGGAGAGGGG + Intergenic
1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG + Intronic
1013343589 6:109238183-109238205 GAGCTCCTCCTGGGAGTAAGAGG + Intergenic
1013454293 6:110316136-110316158 CGCTTCCTCCTGGGGGAGAAGGG + Intronic
1016369444 6:143357038-143357060 CAGTTCTTCCTGGGGGTATAGGG + Intergenic
1016739001 6:147508825-147508847 CCTCTCCTCCAAGGGGAAAAGGG - Intergenic
1018527454 6:164728811-164728833 CAGCTCCAGCTGTGGCAAAAAGG + Intergenic
1019069038 6:169326250-169326272 CTGCTCCTTCTGGAGGAAAGAGG - Intergenic
1019409930 7:901935-901957 CATCTCCTGCTGGGGGAAAAGGG - Intronic
1020068146 7:5205550-5205572 CACCTCCTCCTGTGGGGACATGG - Intronic
1021346109 7:19530477-19530499 TAGCCACTCCTGGGGGAATAAGG + Intergenic
1023984087 7:45085306-45085328 CAGCTCCTCCTGGGGCCAGGAGG - Exonic
1023995828 7:45158239-45158261 CAGCCCACCCTGGGGGATAAGGG - Intronic
1025024877 7:55508143-55508165 CAGCTCCTCAAGGGTTAAAATGG - Intronic
1026738080 7:72961437-72961459 GAGCTCCTCCTGGAGGCAACAGG + Exonic
1026789117 7:73320234-73320256 GAGCTCCTCCTGGAGGCAACAGG + Exonic
1027105654 7:75403631-75403653 GAGCTCCTCCTGGAGGCAACAGG - Exonic
1032034589 7:128512489-128512511 CAGATCCTCCTGGGGTGAAGGGG + Intergenic
1033534977 7:142303750-142303772 CAGCTCCTCCTTGTGGTAAAAGG - Intergenic
1033617413 7:143029816-143029838 TGTCTCCTACTGGGGGAAAAGGG - Intergenic
1034451309 7:151138628-151138650 CAGCGCCGCCTGGGGACAAAGGG - Intronic
1035815482 8:2535104-2535126 GAGCTCCTGCTGTGGGAAACTGG + Intergenic
1036786941 8:11694046-11694068 CGGCACCTCCTTGGGGAAAAGGG - Intronic
1037449875 8:19006091-19006113 CAGATCATCCTGGGCCAAAATGG + Intronic
1039493135 8:37962725-37962747 GAGCTCCTCCTTGGGGCAGATGG + Intergenic
1039640913 8:39219614-39219636 AAGCTGCTGCTGGGGGATAAGGG + Intronic
1040603681 8:48909577-48909599 AACCTGCTCCTGGGGGAAGATGG - Intergenic
1045555216 8:103208877-103208899 CAGGTCCTCCTGGGGGTTGAAGG - Intronic
1045571775 8:103375060-103375082 CTGCTTCTCCTTGGGGAAGAGGG + Intronic
1045829837 8:106445830-106445852 CAGCTCCTCCTGGAGAACAGTGG + Intronic
1046457471 8:114485849-114485871 CAGTTCCGCCTGGGCGAAAGAGG - Intergenic
1048933880 8:139339398-139339420 GGGCTCCTCCAGAGGGAAAAAGG + Intergenic
1049217545 8:141415066-141415088 CACTTCCTCCTGGAGGAAATGGG + Intronic
1049720373 8:144112818-144112840 CAGCGCCTCCACGGGGGAAAGGG - Intronic
1051861283 9:21627661-21627683 GAGTGCTTCCTGGGGGAAAATGG - Intergenic
1053647620 9:40132318-40132340 CAGGTCCTCCTGGGGGAGCTGGG - Intergenic
1053758111 9:41331525-41331547 CAGGTCCTCCTGGGGGAGCTGGG + Intergenic
1054328597 9:63730272-63730294 CAGGTCCTCCTGGGGGAGCTGGG - Intergenic
1054536959 9:66243852-66243874 CAGGTCCTCCTGGGGGAGCTGGG + Intergenic
1056112383 9:83408566-83408588 CAGCTACCCCAGGGGGAAAGGGG + Intronic
1056362248 9:85870290-85870312 CAGTGCCTCCTGAGGGAAAAAGG - Intergenic
1056925642 9:90832136-90832158 CAGTTGCTCCTGGGGAAATATGG - Intronic
1057298352 9:93862157-93862179 CAGCTCCTCCTGGAGGTAGGAGG + Intergenic
1057303430 9:93899434-93899456 CAGCTCCTCCTGAAGGGAAGAGG + Intergenic
1057719869 9:97523371-97523393 CGGCTCCCTCTGGGGGGAAATGG + Intronic
1058835373 9:108855121-108855143 CAGCTCCTCCTCGGGCAGGAAGG + Exonic
1059457911 9:114411452-114411474 CAGCTGATCCTGGGGGAAGCTGG + Intronic
1060552250 9:124491220-124491242 CAGCTCCACCTGGGGGCAGAGGG + Exonic
1060816303 9:126637218-126637240 CAGCTCCTCCTTGGGGACTCTGG + Intronic
1061293833 9:129666586-129666608 CAGCTGCTCCCGGGGCAAACTGG - Intronic
1061788234 9:133043827-133043849 CGGCAGCTCCTGGTGGAAAAAGG - Exonic
1061986114 9:134131295-134131317 CAGCACCACCTGGGGGAAGAGGG + Intergenic
1062020393 9:134316555-134316577 CAGCACCTCCTGTGGGCAAGGGG - Intergenic
1062061042 9:134495114-134495136 CAGCTCCTCCTGGTAGGCAAGGG + Intergenic
1062325444 9:136010458-136010480 CGTCTCCCACTGGGGGAAAAAGG - Exonic
1062344186 9:136107245-136107267 CAGCTCTTCCTGTGAGATAAGGG - Intergenic
1062567844 9:137171202-137171224 CAGCCTGTCCTGGGGGAACAAGG - Intronic
1185832778 X:3317519-3317541 CAGCTTCTCCTGGTGGATAACGG + Exonic
1187237842 X:17484863-17484885 CAGCTCCTCTAGGGTGAACAAGG + Intronic
1187595077 X:20762267-20762289 CAGCTTCTTATGGGAGAAAAAGG + Intergenic
1189140477 X:38600238-38600260 CAGCTCTTCCAGGAGGAAAACGG - Intronic
1189270298 X:39746806-39746828 CAGCTCTTCCTGGGGGAGCCTGG - Intergenic
1189287946 X:39865481-39865503 AAGCTCCTGCTGGGAGAAACTGG + Intergenic
1190108785 X:47576398-47576420 GACGTCCTCCTGGGGGACAAGGG + Exonic
1190760595 X:53434628-53434650 CTGCTCCGCGTGGGGGAAGAGGG + Intergenic
1191857492 X:65639056-65639078 TGGCTCCTCCTGAGGGAAATAGG + Intronic
1194680283 X:96843721-96843743 CAGCTCCTCCCTGCGGCAAAAGG + Intronic
1194842092 X:98754878-98754900 CAGCTGCTGCTGGGGGATGAGGG + Intergenic
1195001338 X:100646060-100646082 CTCCTCCTCCTGGGAGGAAAAGG + Intronic
1196191042 X:112794956-112794978 TATGTCCTCCTGTGGGAAAATGG - Intronic
1198007828 X:132516808-132516830 CTGCTCCTCTTGGGCCAAAAAGG + Intergenic
1199607050 X:149585928-149585950 CAGGTCCTGCTGGGAGACAAGGG - Intronic
1199632072 X:149783440-149783462 CAGGTCCTGCTGGGAGACAAGGG + Intronic
1199754455 X:150851406-150851428 CAGCTCCTCATTGGTGAAAGAGG - Intronic
1199792980 X:151172233-151172255 CAGCTCCACCTGGGGGAGACGGG + Intergenic
1201243318 Y:11979374-11979396 CAGCTTCTCCTGGTGGATAATGG - Intergenic
1201264594 Y:12193756-12193778 CAGGTCCTCCAGGTGGAAGAAGG + Intergenic