ID: 916450647

View in Genome Browser
Species Human (GRCh38)
Location 1:164917309-164917331
Sequence TCTCTTGTTTCTGGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916450647_916450652 -1 Left 916450647 1:164917309-164917331 CCAGGTTCCCCAGAAACAAGAGA No data
Right 916450652 1:164917331-164917353 AATAAAAGGCAGAAGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916450647 Original CRISPR TCTCTTGTTTCTGGGGAACC TGG (reversed) Intergenic
No off target data available for this crispr