ID: 916450649

View in Genome Browser
Species Human (GRCh38)
Location 1:164917317-164917339
Sequence CCTTTTATTCTCTTGTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916450649_916450652 -9 Left 916450649 1:164917317-164917339 CCCAGAAACAAGAGAATAAAAGG No data
Right 916450652 1:164917331-164917353 AATAAAAGGCAGAAGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916450649 Original CRISPR CCTTTTATTCTCTTGTTTCT GGG (reversed) Intergenic
No off target data available for this crispr