ID: 916450652

View in Genome Browser
Species Human (GRCh38)
Location 1:164917331-164917353
Sequence AATAAAAGGCAGAAGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916450647_916450652 -1 Left 916450647 1:164917309-164917331 CCAGGTTCCCCAGAAACAAGAGA No data
Right 916450652 1:164917331-164917353 AATAAAAGGCAGAAGATGAATGG No data
916450649_916450652 -9 Left 916450649 1:164917317-164917339 CCCAGAAACAAGAGAATAAAAGG No data
Right 916450652 1:164917331-164917353 AATAAAAGGCAGAAGATGAATGG No data
916450648_916450652 -8 Left 916450648 1:164917316-164917338 CCCCAGAAACAAGAGAATAAAAG No data
Right 916450652 1:164917331-164917353 AATAAAAGGCAGAAGATGAATGG No data
916450651_916450652 -10 Left 916450651 1:164917318-164917340 CCAGAAACAAGAGAATAAAAGGC No data
Right 916450652 1:164917331-164917353 AATAAAAGGCAGAAGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916450652 Original CRISPR AATAAAAGGCAGAAGATGAA TGG Intergenic
No off target data available for this crispr