ID: 916451214

View in Genome Browser
Species Human (GRCh38)
Location 1:164922271-164922293
Sequence CATGGTAATAACAAAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916451209_916451214 16 Left 916451209 1:164922232-164922254 CCAAGTGTATCTGGCCACTAAAT No data
Right 916451214 1:164922271-164922293 CATGGTAATAACAAAGTTGCTGG No data
916451210_916451214 2 Left 916451210 1:164922246-164922268 CCACTAAATCAGTAATTCTTAAG No data
Right 916451214 1:164922271-164922293 CATGGTAATAACAAAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916451214 Original CRISPR CATGGTAATAACAAAGTTGC TGG Intergenic
No off target data available for this crispr