ID: 916459112

View in Genome Browser
Species Human (GRCh38)
Location 1:165004127-165004149
Sequence CTTTTTGCACAAATGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916459104_916459112 27 Left 916459104 1:165004077-165004099 CCAAATTGACATGCAGATTCACT No data
Right 916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG No data
916459107_916459112 -3 Left 916459107 1:165004107-165004129 CCATCACAACTTCAGAGACCCTT No data
Right 916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG No data
916459106_916459112 -2 Left 916459106 1:165004106-165004128 CCCATCACAACTTCAGAGACCCT No data
Right 916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG No data
916459105_916459112 -1 Left 916459105 1:165004105-165004127 CCCCATCACAACTTCAGAGACCC No data
Right 916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916459112 Original CRISPR CTTTTTGCACAAATGGAAGA GGG Intergenic
No off target data available for this crispr