ID: 916459850

View in Genome Browser
Species Human (GRCh38)
Location 1:165012166-165012188
Sequence TCTGGAAACAAATGCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916459847_916459850 -5 Left 916459847 1:165012148-165012170 CCATTTTCCTTGACATTATCTGG No data
Right 916459850 1:165012166-165012188 TCTGGAAACAAATGCTCTGCTGG No data
916459846_916459850 0 Left 916459846 1:165012143-165012165 CCTGGCCATTTTCCTTGACATTA No data
Right 916459850 1:165012166-165012188 TCTGGAAACAAATGCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916459850 Original CRISPR TCTGGAAACAAATGCTCTGC TGG Intergenic
No off target data available for this crispr