ID: 916462056

View in Genome Browser
Species Human (GRCh38)
Location 1:165035252-165035274
Sequence AGGTTGGGATTGGCTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916462056_916462065 25 Left 916462056 1:165035252-165035274 CCAGGGGCAGCCAATCCCAACCT No data
Right 916462065 1:165035300-165035322 TCTACTCCGTGCCAAAGCCTGGG No data
916462056_916462067 27 Left 916462056 1:165035252-165035274 CCAGGGGCAGCCAATCCCAACCT No data
Right 916462067 1:165035302-165035324 TACTCCGTGCCAAAGCCTGGGGG No data
916462056_916462066 26 Left 916462056 1:165035252-165035274 CCAGGGGCAGCCAATCCCAACCT No data
Right 916462066 1:165035301-165035323 CTACTCCGTGCCAAAGCCTGGGG No data
916462056_916462064 24 Left 916462056 1:165035252-165035274 CCAGGGGCAGCCAATCCCAACCT No data
Right 916462064 1:165035299-165035321 CTCTACTCCGTGCCAAAGCCTGG No data
916462056_916462058 -9 Left 916462056 1:165035252-165035274 CCAGGGGCAGCCAATCCCAACCT No data
Right 916462058 1:165035266-165035288 TCCCAACCTGTCTCTTCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916462056 Original CRISPR AGGTTGGGATTGGCTGCCCC TGG (reversed) Intergenic
No off target data available for this crispr