ID: 916462399

View in Genome Browser
Species Human (GRCh38)
Location 1:165040172-165040194
Sequence CATGTGATTTCTTCATCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916462399_916462413 29 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG No data
916462399_916462405 3 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462405 1:165040198-165040220 AATCCCAACCTCCAAGGGATGGG No data
916462399_916462404 2 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462404 1:165040197-165040219 CAATCCCAACCTCCAAGGGATGG No data
916462399_916462402 -2 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462402 1:165040193-165040215 TGGCCAATCCCAACCTCCAAGGG No data
916462399_916462406 4 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462406 1:165040199-165040221 ATCCCAACCTCCAAGGGATGGGG No data
916462399_916462414 30 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462414 1:165040225-165040247 TACACTCCTTTAGAGTGGAGGGG No data
916462399_916462401 -3 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462401 1:165040192-165040214 ATGGCCAATCCCAACCTCCAAGG No data
916462399_916462411 25 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462411 1:165040220-165040242 GGAAGTACACTCCTTTAGAGTGG No data
916462399_916462412 28 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462412 1:165040223-165040245 AGTACACTCCTTTAGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916462399 Original CRISPR CATGTGATTTCTTCATCCAA TGG (reversed) Intergenic
No off target data available for this crispr