ID: 916462408

View in Genome Browser
Species Human (GRCh38)
Location 1:165040202-165040224
Sequence CTTCCCCATCCCTTGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916462408_916462414 0 Left 916462408 1:165040202-165040224 CCAACCTCCAAGGGATGGGGAAG No data
Right 916462414 1:165040225-165040247 TACACTCCTTTAGAGTGGAGGGG No data
916462408_916462413 -1 Left 916462408 1:165040202-165040224 CCAACCTCCAAGGGATGGGGAAG No data
Right 916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG No data
916462408_916462412 -2 Left 916462408 1:165040202-165040224 CCAACCTCCAAGGGATGGGGAAG No data
Right 916462412 1:165040223-165040245 AGTACACTCCTTTAGAGTGGAGG No data
916462408_916462411 -5 Left 916462408 1:165040202-165040224 CCAACCTCCAAGGGATGGGGAAG No data
Right 916462411 1:165040220-165040242 GGAAGTACACTCCTTTAGAGTGG No data
916462408_916462415 1 Left 916462408 1:165040202-165040224 CCAACCTCCAAGGGATGGGGAAG No data
Right 916462415 1:165040226-165040248 ACACTCCTTTAGAGTGGAGGGGG No data
916462408_916462416 2 Left 916462408 1:165040202-165040224 CCAACCTCCAAGGGATGGGGAAG No data
Right 916462416 1:165040227-165040249 CACTCCTTTAGAGTGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916462408 Original CRISPR CTTCCCCATCCCTTGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr