ID: 916462413

View in Genome Browser
Species Human (GRCh38)
Location 1:165040224-165040246
Sequence GTACACTCCTTTAGAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916462409_916462413 -5 Left 916462409 1:165040206-165040228 CCTCCAAGGGATGGGGAAGTACA No data
Right 916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG No data
916462403_916462413 5 Left 916462403 1:165040196-165040218 CCAATCCCAACCTCCAAGGGATG No data
Right 916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG No data
916462407_916462413 0 Left 916462407 1:165040201-165040223 CCCAACCTCCAAGGGATGGGGAA No data
Right 916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG No data
916462410_916462413 -8 Left 916462410 1:165040209-165040231 CCAAGGGATGGGGAAGTACACTC No data
Right 916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG No data
916462408_916462413 -1 Left 916462408 1:165040202-165040224 CCAACCTCCAAGGGATGGGGAAG No data
Right 916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG No data
916462399_916462413 29 Left 916462399 1:165040172-165040194 CCATTGGATGAAGAAATCACATG No data
Right 916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916462413 Original CRISPR GTACACTCCTTTAGAGTGGA GGG Intergenic
No off target data available for this crispr