ID: 916463284

View in Genome Browser
Species Human (GRCh38)
Location 1:165048271-165048293
Sequence GGCAAAGAAGGTTTAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916463284_916463297 -1 Left 916463284 1:165048271-165048293 CCCTCCCCTAAACCTTCTTTGCC No data
Right 916463297 1:165048293-165048315 CTCTAGGGAACAGGGAACTGGGG No data
916463284_916463296 -2 Left 916463284 1:165048271-165048293 CCCTCCCCTAAACCTTCTTTGCC No data
Right 916463296 1:165048292-165048314 CCTCTAGGGAACAGGGAACTGGG No data
916463284_916463293 -9 Left 916463284 1:165048271-165048293 CCCTCCCCTAAACCTTCTTTGCC No data
Right 916463293 1:165048285-165048307 TTCTTTGCCTCTAGGGAACAGGG No data
916463284_916463292 -10 Left 916463284 1:165048271-165048293 CCCTCCCCTAAACCTTCTTTGCC No data
Right 916463292 1:165048284-165048306 CTTCTTTGCCTCTAGGGAACAGG No data
916463284_916463294 -3 Left 916463284 1:165048271-165048293 CCCTCCCCTAAACCTTCTTTGCC No data
Right 916463294 1:165048291-165048313 GCCTCTAGGGAACAGGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916463284 Original CRISPR GGCAAAGAAGGTTTAGGGGA GGG (reversed) Intergenic