ID: 916464776

View in Genome Browser
Species Human (GRCh38)
Location 1:165062882-165062904
Sequence TGAGATATGCGTTGAGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916464776_916464785 3 Left 916464776 1:165062882-165062904 CCCTACCCTCAACGCATATCTCA No data
Right 916464785 1:165062908-165062930 CCACCCCTAGAAAGAGGTTCAGG No data
916464776_916464790 13 Left 916464776 1:165062882-165062904 CCCTACCCTCAACGCATATCTCA No data
Right 916464790 1:165062918-165062940 AAAGAGGTTCAGGAGGAGAAAGG No data
916464776_916464780 -3 Left 916464776 1:165062882-165062904 CCCTACCCTCAACGCATATCTCA No data
Right 916464780 1:165062902-165062924 TCACCCCCACCCCTAGAAAGAGG No data
916464776_916464787 6 Left 916464776 1:165062882-165062904 CCCTACCCTCAACGCATATCTCA No data
Right 916464787 1:165062911-165062933 CCCCTAGAAAGAGGTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916464776 Original CRISPR TGAGATATGCGTTGAGGGTA GGG (reversed) Intergenic
No off target data available for this crispr