ID: 916465994

View in Genome Browser
Species Human (GRCh38)
Location 1:165075291-165075313
Sequence ACCCTCTCCCTGCCAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916465994_916465999 20 Left 916465994 1:165075291-165075313 CCAGGCTTTGGCAGGGAGAGGGT No data
Right 916465999 1:165075334-165075356 GCTCCGGACATCCACTGCCAAGG No data
916465994_916465996 -9 Left 916465994 1:165075291-165075313 CCAGGCTTTGGCAGGGAGAGGGT No data
Right 916465996 1:165075305-165075327 GGAGAGGGTGCCAGGTCTTCAGG No data
916465994_916466003 27 Left 916465994 1:165075291-165075313 CCAGGCTTTGGCAGGGAGAGGGT No data
Right 916466003 1:165075341-165075363 ACATCCACTGCCAAGGGGATAGG No data
916465994_916466001 22 Left 916465994 1:165075291-165075313 CCAGGCTTTGGCAGGGAGAGGGT No data
Right 916466001 1:165075336-165075358 TCCGGACATCCACTGCCAAGGGG No data
916465994_916466000 21 Left 916465994 1:165075291-165075313 CCAGGCTTTGGCAGGGAGAGGGT No data
Right 916466000 1:165075335-165075357 CTCCGGACATCCACTGCCAAGGG No data
916465994_916465998 4 Left 916465994 1:165075291-165075313 CCAGGCTTTGGCAGGGAGAGGGT No data
Right 916465998 1:165075318-165075340 GGTCTTCAGGCTCTGCGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916465994 Original CRISPR ACCCTCTCCCTGCCAAAGCC TGG (reversed) Intergenic
No off target data available for this crispr