ID: 916475912

View in Genome Browser
Species Human (GRCh38)
Location 1:165168839-165168861
Sequence GTACACTGACTGGCAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916475909_916475912 -10 Left 916475909 1:165168826-165168848 CCCACAGTACTTAGTACACTGAC No data
Right 916475912 1:165168839-165168861 GTACACTGACTGGCAAACACTGG No data
916475908_916475912 -1 Left 916475908 1:165168817-165168839 CCTTCTGGACCCACAGTACTTAG No data
Right 916475912 1:165168839-165168861 GTACACTGACTGGCAAACACTGG No data
916475906_916475912 20 Left 916475906 1:165168796-165168818 CCTTCAACTAGTCTGTGGGCTCC No data
Right 916475912 1:165168839-165168861 GTACACTGACTGGCAAACACTGG No data
916475905_916475912 21 Left 916475905 1:165168795-165168817 CCCTTCAACTAGTCTGTGGGCTC No data
Right 916475912 1:165168839-165168861 GTACACTGACTGGCAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916475912 Original CRISPR GTACACTGACTGGCAAACAC TGG Intergenic
No off target data available for this crispr