ID: 916476438

View in Genome Browser
Species Human (GRCh38)
Location 1:165173877-165173899
Sequence TAGGTTCGTAAACCTGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916476438_916476445 30 Left 916476438 1:165173877-165173899 CCAGAATCAGGTTTACGAACCTA No data
Right 916476445 1:165173930-165173952 CTTAAGCTCTGCCCTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916476438 Original CRISPR TAGGTTCGTAAACCTGATTC TGG (reversed) Intergenic
No off target data available for this crispr