ID: 916476812

View in Genome Browser
Species Human (GRCh38)
Location 1:165177466-165177488
Sequence GATACCCATGCCCTAACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916476805_916476812 28 Left 916476805 1:165177415-165177437 CCCAGCAGAGGAAAACACACTGT No data
Right 916476812 1:165177466-165177488 GATACCCATGCCCTAACACCTGG No data
916476806_916476812 27 Left 916476806 1:165177416-165177438 CCAGCAGAGGAAAACACACTGTG No data
Right 916476812 1:165177466-165177488 GATACCCATGCCCTAACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916476812 Original CRISPR GATACCCATGCCCTAACACC TGG Intergenic
No off target data available for this crispr