ID: 916476916

View in Genome Browser
Species Human (GRCh38)
Location 1:165178311-165178333
Sequence GTGTCAAGGGGGAAACCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916476916_916476930 20 Left 916476916 1:165178311-165178333 CCACCTGGTTTCCCCCTTGACAC No data
Right 916476930 1:165178354-165178376 AATTCAAGATGAGATTTGGGTGG 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
916476916_916476927 -8 Left 916476916 1:165178311-165178333 CCACCTGGTTTCCCCCTTGACAC No data
Right 916476927 1:165178326-165178348 CTTGACACATGGGGATTATGGGG 0: 171
1: 489
2: 715
3: 790
4: 747
916476916_916476926 -9 Left 916476916 1:165178311-165178333 CCACCTGGTTTCCCCCTTGACAC No data
Right 916476926 1:165178325-165178347 CCTTGACACATGGGGATTATGGG 0: 182
1: 965
2: 1813
3: 2794
4: 3882
916476916_916476928 16 Left 916476916 1:165178311-165178333 CCACCTGGTTTCCCCCTTGACAC No data
Right 916476928 1:165178350-165178372 TTATAATTCAAGATGAGATTTGG 0: 297
1: 3481
2: 11297
3: 13761
4: 11200
916476916_916476924 -10 Left 916476916 1:165178311-165178333 CCACCTGGTTTCCCCCTTGACAC No data
Right 916476924 1:165178324-165178346 CCCTTGACACATGGGGATTATGG 0: 188
1: 924
2: 1767
3: 2780
4: 3790
916476916_916476929 17 Left 916476916 1:165178311-165178333 CCACCTGGTTTCCCCCTTGACAC No data
Right 916476929 1:165178351-165178373 TATAATTCAAGATGAGATTTGGG 0: 801
1: 8426
2: 10901
3: 10162
4: 6997

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916476916 Original CRISPR GTGTCAAGGGGGAAACCAGG TGG (reversed) Intergenic
No off target data available for this crispr