ID: 916477600

View in Genome Browser
Species Human (GRCh38)
Location 1:165185255-165185277
Sequence CTGAATTAGTTGAGGGCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916477600_916477606 0 Left 916477600 1:165185255-165185277 CCTACTGCCCTCAACTAATTCAG No data
Right 916477606 1:165185278-165185300 GACACAAGGAGGTTACTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916477600 Original CRISPR CTGAATTAGTTGAGGGCAGT AGG (reversed) Intergenic
No off target data available for this crispr