ID: 916478910

View in Genome Browser
Species Human (GRCh38)
Location 1:165197550-165197572
Sequence CAGTGTAGGTAAAAGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916478910_916478914 -9 Left 916478910 1:165197550-165197572 CCTCCATACTTTTACCTACACTG No data
Right 916478914 1:165197564-165197586 CCTACACTGGTCCTATTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916478910 Original CRISPR CAGTGTAGGTAAAAGTATGG AGG (reversed) Intergenic
No off target data available for this crispr