ID: 916479114

View in Genome Browser
Species Human (GRCh38)
Location 1:165199377-165199399
Sequence TTCCCAGAACCCTCCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 318}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916479112_916479114 -9 Left 916479112 1:165199363-165199385 CCATGGTAGACTCTTTCCCAGAA No data
Right 916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG 0: 1
1: 0
2: 2
3: 36
4: 318
916479106_916479114 18 Left 916479106 1:165199336-165199358 CCAATGCACCATCCACTAGGGGC No data
Right 916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG 0: 1
1: 0
2: 2
3: 36
4: 318
916479109_916479114 10 Left 916479109 1:165199344-165199366 CCATCCACTAGGGGCTGGGCCAT No data
Right 916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG 0: 1
1: 0
2: 2
3: 36
4: 318
916479111_916479114 6 Left 916479111 1:165199348-165199370 CCACTAGGGGCTGGGCCATGGTA No data
Right 916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG 0: 1
1: 0
2: 2
3: 36
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916479114 Original CRISPR TTCCCAGAACCCTCCCCTGG AGG Intergenic
900023156 1:199460-199482 TTCCCAGAACCCGGCCGGGGCGG + Intergenic
900098082 1:948457-948479 TGCCCAGGCCCCTCCCCAGGAGG + Intronic
900300198 1:1973296-1973318 TTCCCAGACCCCTGCCCAGCTGG - Intronic
900350910 1:2234123-2234145 TTTCCGGAACCCTCACCTGGGGG - Intronic
900626812 1:3612059-3612081 TTCCCCGACCCCTGCCCTGCGGG - Intergenic
900874161 1:5329737-5329759 TCCCCAGAACCCACCCATGCTGG - Intergenic
901099977 1:6712416-6712438 TTCCCAGATCCTTCCCCTGCAGG - Intergenic
902359700 1:15935693-15935715 CTCCCAGCACCCTCCCGAGGAGG + Exonic
902381218 1:16053354-16053376 TACCCAGCAGCCTTCCCTGGAGG - Intronic
902482550 1:16719343-16719365 CTCCCAGACCACTCCCCAGGAGG + Intergenic
902610245 1:17592874-17592896 TCCCCATAACCCTCCCATGGGGG - Intronic
902613261 1:17609355-17609377 TTTCCACAGCCCACCCCTGGAGG - Intronic
902701063 1:18172482-18172504 TCCCCAGAACCCGACCCTGCTGG - Intronic
903659765 1:24969880-24969902 TCCTCAGAGCCCACCCCTGGAGG - Intergenic
904477717 1:30775624-30775646 CTCCCAGAAGCGTCTCCTGGGGG - Intergenic
905325330 1:37147781-37147803 TTGCCAGCACCCAACCCTGGGGG - Intergenic
905571111 1:39006459-39006481 ATCCCAAAACCCAGCCCTGGTGG - Intergenic
906142829 1:43543947-43543969 CTCCCATACCCCTCACCTGGGGG - Intronic
906237220 1:44219300-44219322 CTCTCAGAACCCTCCACTCGGGG - Intronic
907560524 1:55383410-55383432 TCCCCAGACCCCTCAGCTGGAGG + Intergenic
908796992 1:67840017-67840039 CCCCCAGCACCCTCCCCTGAGGG - Intergenic
910659503 1:89656161-89656183 TTCCAAGAACTCTCCCTTGAGGG + Intronic
911718848 1:101167690-101167712 TTCCCAGAATGCTCTCCTCGTGG + Intergenic
912209278 1:107541012-107541034 GTCCCTGAAATCTCCCCTGGGGG + Intergenic
912712117 1:111957428-111957450 TTCCCAGAAGCATCCCTTGTTGG - Intronic
914845697 1:151282505-151282527 TTCCTAGAAGCCGCCCCAGGGGG - Intronic
915841267 1:159215367-159215389 TTCTCACAACCCTCTCCTGTGGG + Intergenic
916479114 1:165199377-165199399 TTCCCAGAACCCTCCCCTGGAGG + Intergenic
917716270 1:177741034-177741056 TTCCCAGAAACCTTCATTGGAGG - Intergenic
917770307 1:178269882-178269904 ATCCAAGAACCCTCTCTTGGGGG + Intronic
923790640 1:237108217-237108239 TTCCCAGGCCCCTCTCCTGGAGG - Intronic
1062885423 10:1012285-1012307 TTCACAGAACCCTCCCTGTGAGG + Intronic
1064966763 10:21022010-21022032 TTCACAGATGACTCCCCTGGTGG + Intronic
1068828451 10:61466097-61466119 TTACCAGAAACCTACCCTGCTGG + Intergenic
1069513068 10:69056549-69056571 CTCCCAGGTCCCTCCTCTGGCGG - Intergenic
1069641439 10:69958138-69958160 TCCCCAGAATCCATCCCTGGAGG + Intronic
1069866447 10:71506615-71506637 TTGCTGGAAACCTCCCCTGGTGG + Intronic
1070499016 10:77052979-77053001 TTCCCAGAACTCTTCTCAGGAGG - Intronic
1070597701 10:77844303-77844325 TTCCAAGAATCCTCTCCTGGTGG - Intronic
1070623194 10:78029635-78029657 TTCCCCGCACCGTCACCTGGTGG + Intergenic
1070931786 10:80266068-80266090 TTCCCAGAAGCCTCTCTGGGAGG - Intergenic
1071908888 10:90207884-90207906 TTCTCAGAATTCTCCCATGGAGG + Intergenic
1072760784 10:98054846-98054868 TCCCCAGCACCCTGCACTGGGGG - Intergenic
1073116793 10:101095881-101095903 TCCCCATCACCCTCCGCTGGCGG - Intronic
1075633861 10:124017334-124017356 GTGCCAGAGCCCTCCCCTGCAGG - Intronic
1075706568 10:124505844-124505866 AGCCAAGAACCCTCGCCTGGAGG + Intronic
1078108903 11:8376165-8376187 TTCCCAGAGCCTTGCCCTGGTGG - Intergenic
1078194254 11:9121768-9121790 TCCCCAGAAGCCTTCCCTGACGG + Intronic
1078447250 11:11413611-11413633 TTCCCAGAAGCCTCCACTCTGGG + Intronic
1078930183 11:15906500-15906522 TTTTCACAACACTCCCCTGGAGG + Intergenic
1079173663 11:18119728-18119750 ATCCAAGAACCCTCTCTTGGGGG + Intronic
1083272617 11:61580048-61580070 CTCCCAGGCCACTCCCCTGGCGG + Intronic
1083612660 11:64011564-64011586 CTCCCATAACCCTGCCCTCGGGG + Intronic
1083922937 11:65790177-65790199 TTCCTGGAGCCCTTCCCTGGTGG - Intronic
1085175313 11:74481643-74481665 AACCCAGATCCCTTCCCTGGAGG - Intergenic
1085451279 11:76635452-76635474 TTCCCAGAACCCTCCTTCTGTGG - Intergenic
1085512191 11:77094000-77094022 TTCCCAGCACCTGCCCCTGGGGG - Intronic
1088692776 11:112342053-112342075 TTCCCAGGTCCATCCTCTGGAGG + Intergenic
1089646865 11:119886291-119886313 TCCCCAGAGACCTCCCCTGCTGG + Intergenic
1090800522 11:130168747-130168769 TTCCTGGTGCCCTCCCCTGGGGG + Intronic
1091186925 11:133655625-133655647 TTCCCAGGCTCCTCCCCTGGAGG + Intergenic
1091237459 11:134031601-134031623 ATCTCTGTACCCTCCCCTGGGGG + Intergenic
1091271412 11:134314256-134314278 TTCCCAGTACCCACCCCAGGTGG - Intronic
1091376855 12:30998-31020 TTCCCAGAACCCGGCCGGGGCGG + Intergenic
1091750477 12:3018846-3018868 TTCCCAGCCTCCTCCCCTGGGGG - Intronic
1093707706 12:22293259-22293281 TTCTCAGCACCATCCACTGGTGG - Intronic
1096617491 12:52842172-52842194 CTCCAAGAACCCTCCCCAGAGGG + Intronic
1097277604 12:57823960-57823982 TTCTCAGGTCCCTCCCCAGGCGG + Exonic
1097579591 12:61438514-61438536 TTCAAATAACACTCCCCTGGAGG + Intergenic
1101024010 12:100583043-100583065 ATCCAAGAACCCTCTCTTGGGGG - Intronic
1102049559 12:109852795-109852817 CTCCCAGAACCCTGGCCTGCTGG - Intronic
1102687466 12:114735870-114735892 TTCCGAGAATCCTCCACTTGGGG + Intergenic
1102926386 12:116829382-116829404 GCCCCAGAAACATCCCCTGGAGG - Intronic
1103949339 12:124542644-124542666 CTCCCAGAAGCCTTCCCTGCAGG + Intronic
1104786829 12:131455575-131455597 TTCTCATAACCCTCCCTTGGAGG - Intergenic
1104821941 12:131682315-131682337 TTCCCCGCCCCGTCCCCTGGAGG - Intergenic
1104821969 12:131682386-131682408 TTCCCTGCCCCATCCCCTGGAGG - Intergenic
1106411421 13:29514097-29514119 ATCCCAGAACAGTCCCCGGGAGG + Exonic
1106598903 13:31170632-31170654 GACCCAGAACTCTTCCCTGGGGG + Intergenic
1106687862 13:32080703-32080725 AACCCAGACTCCTCCCCTGGTGG + Intronic
1107132400 13:36910709-36910731 TTCCTGGAAACCTTCCCTGGAGG + Intronic
1108594158 13:51935930-51935952 TTCCCAGAACCACCCACAGGTGG + Intronic
1110375073 13:74784003-74784025 TTCTCAGAAAACTCCCTTGGAGG + Intergenic
1112726929 13:102315399-102315421 TTCTCTCAACCCTCCCCTGTAGG + Intronic
1113597882 13:111547454-111547476 TGGCCAGACCCCTCCCCAGGTGG + Intergenic
1116384624 14:44315130-44315152 TTCATAGTACCCTCTCCTGGAGG - Intergenic
1118468914 14:66056824-66056846 TTCCCAGACCCTTCCTCTGGGGG - Intergenic
1121017176 14:90555924-90555946 TCCCCATCACCCTCCCCTGACGG - Intronic
1121684966 14:95829079-95829101 TTTGCAGTACCCTCCCCTGTGGG - Intergenic
1122003646 14:98684721-98684743 GTCCTAGAATCCTGCCCTGGAGG + Intergenic
1122898000 14:104769856-104769878 TGGCCAGCACCCTCTCCTGGGGG - Exonic
1124414893 15:29466636-29466658 TCCCCTGGGCCCTCCCCTGGGGG - Intronic
1124414908 15:29466670-29466692 CTCCCCGGGCCCTCCCCTGGGGG - Intronic
1124414962 15:29466805-29466827 TCCCCTGGGCCCTCCCCTGGGGG - Intronic
1124414977 15:29466839-29466861 TCCCCTGGGCCCTCCCCTGGGGG - Intronic
1124415019 15:29466941-29466963 TCCCCTGGGCCCTCCCCTGGGGG - Intronic
1124415034 15:29466975-29466997 CTCCCCGGGCCCTCCCCTGGGGG - Intronic
1124972001 15:34496728-34496750 GTCTCAGCACCCTCCCCAGGGGG + Intergenic
1128331816 15:66761015-66761037 TTCCCAGGCCCCGCCCCTGGAGG - Intronic
1128380482 15:67108270-67108292 TTCACAGACCTCTCCCATGGTGG - Intronic
1128538688 15:68509918-68509940 TTCCAAGAAGCCTTCCCTGATGG - Intergenic
1128944073 15:71809744-71809766 TTCCCAGAACCGTCCCCCGTAGG - Intronic
1129247971 15:74291544-74291566 GGCCCTGAACCCTCCCCAGGGGG - Intronic
1130584378 15:85169043-85169065 TTCCCACACTCCTCCACTGGGGG - Intergenic
1130994281 15:88895347-88895369 TTCCCCGGACCCTGCCCGGGAGG + Intronic
1131069008 15:89452624-89452646 CACCCAGAACCCTCCCCCAGAGG - Intergenic
1132450066 15:101961996-101962018 TTCCCAGAACCCGGCCGGGGCGG - Intergenic
1132741922 16:1418390-1418412 CTCCCAGATCGCTGCCCTGGAGG + Intergenic
1133641575 16:7722329-7722351 ATCCAAGAACCCTCCCCTTGGGG + Intergenic
1134449861 16:14356638-14356660 TTAACAGAGGCCTCCCCTGGGGG - Intergenic
1134604410 16:15558917-15558939 TTCCCAGAAGCCTGCCCAAGCGG + Intronic
1135137804 16:19897743-19897765 TTCCCAGAACCCACCCATGCTGG - Intergenic
1135429977 16:22374613-22374635 TTGGCAGAACCCTCCCCGGCCGG + Exonic
1136224177 16:28847437-28847459 TTCCCTAATTCCTCCCCTGGAGG + Intronic
1136552782 16:30990340-30990362 TTCCCAGAACGCCCCTCTGCAGG - Exonic
1136682441 16:31976109-31976131 TTCCCAGAGCCCTCCCTTCTAGG - Intergenic
1136782700 16:32917277-32917299 TTCCCAGAGCCCTCCCTTCTAGG - Intergenic
1136887096 16:33936573-33936595 TTCCCAGAGCCCTCCCTTCTAGG + Intergenic
1137249750 16:46732846-46732868 TTCCCAGGACCCTCATCCGGTGG - Intronic
1137550023 16:49431183-49431205 TTACCAGCACCCTCCCATGGCGG + Intergenic
1138859763 16:60742545-60742567 TTCCCAGAATCCTCCACTGCTGG + Intergenic
1140631353 16:76856469-76856491 TTCCCAGAACCCAACCATGCTGG - Intergenic
1141333045 16:83129577-83129599 ATCCCAGTGCCATCCCCTGGGGG - Intronic
1141360269 16:83389026-83389048 TTCTCAGAGCCCTTCCCTGTCGG - Intronic
1141370577 16:83482620-83482642 TTGCCAGTACCTTCCCCTGGAGG - Intronic
1141911301 16:87060179-87060201 TCCCCAGCACCCTCTCCTGGAGG + Intergenic
1142231899 16:88903862-88903884 TTTCCAAAGCCCTCCCATGGAGG + Intronic
1203085354 16_KI270728v1_random:1181261-1181283 TTCCCAGAGCCCTCCCTTCTAGG - Intergenic
1142729972 17:1847338-1847360 CTCCCACAACCATGCCCTGGAGG - Intronic
1143708749 17:8718721-8718743 TCCACAGATACCTCCCCTGGAGG + Intergenic
1144479042 17:15613786-15613808 TTCCCAGACACCTCCCCTCTTGG - Intronic
1144919262 17:18749947-18749969 TTCCCAGACACCTCCCCTCTTGG + Intronic
1145944607 17:28763879-28763901 TTTCCAGACCCCTCCACTAGGGG + Intronic
1146431602 17:32801450-32801472 TTCCTAGACCCCTCCCCTGCTGG - Intronic
1146558914 17:33851242-33851264 TGCCTAGGGCCCTCCCCTGGTGG - Intronic
1147142962 17:38469447-38469469 TTCCCAGAGCCCTCCCTTCTGGG - Intronic
1148159084 17:45439885-45439907 TTCACTGTACCCTCCCCTTGGGG + Intronic
1148565820 17:48632342-48632364 TTCCCAGATCTCTTCTCTGGGGG + Intronic
1148905606 17:50909912-50909934 ACCCCAGACCCCTTCCCTGGAGG - Intergenic
1149651000 17:58276439-58276461 CTCCCAGAACCCTTCTCTGCAGG + Intronic
1150611158 17:66734162-66734184 GTCCAAGAACCCTCCTCTTGGGG - Intronic
1151986831 17:77548997-77549019 TTTCCAGAAGCCTTGCCTGGGGG - Intergenic
1152519344 17:80846184-80846206 TTCCCAGCACGCTCCTCTTGCGG + Intronic
1153585002 18:6612005-6612027 TTCCCTTCTCCCTCCCCTGGTGG + Intergenic
1153636579 18:7117913-7117935 CACCCAGACCCCTCCCCCGGGGG + Intergenic
1154374052 18:13794202-13794224 TGCCTAGAACCCTGCCCAGGTGG + Intergenic
1155076174 18:22357393-22357415 TTCCCAGAGCCCACCACAGGAGG - Intergenic
1155720276 18:29002625-29002647 ATCCAAGAACCCTCTCTTGGAGG - Intergenic
1156406904 18:36791427-36791449 TTCCCAGAACCCTGAGGTGGAGG + Intronic
1158515687 18:58128385-58128407 GTCAAAGAACCCTCCCCTTGAGG + Intronic
1160038337 18:75321586-75321608 GTCCCAGATCCTTGCCCTGGTGG + Intergenic
1160318261 18:77867677-77867699 ATCCAAGAACCCTCTCTTGGAGG - Intergenic
1160958823 19:1708162-1708184 TTCCCACACCCCTCAGCTGGGGG + Intergenic
1161229056 19:3163362-3163384 GTCCCAGAACCCTGCCCAGGAGG - Exonic
1162139833 19:8579041-8579063 TTCCTAGAAGCCTCCCCTGATGG - Intergenic
1162689020 19:12413720-12413742 TTTCCAGAGCCTTCCCCAGGGGG - Intronic
1163167435 19:15507993-15508015 TCCCCGGCACCCACCCCTGGAGG - Intergenic
1163386201 19:17001863-17001885 TTCCCGTGCCCCTCCCCTGGGGG - Intronic
1163682053 19:18688390-18688412 TTCCCAGACCCCTCCCTCAGGGG - Intronic
1163764054 19:19152753-19152775 TTCCCAGACCCCTGCCCAAGCGG + Intronic
1165202954 19:34160015-34160037 TTCCCAATACCATCCCCTTGAGG - Intergenic
1165267985 19:34677627-34677649 TTCCCAGAATCCTCCCCCTGCGG - Intronic
1166091148 19:40509912-40509934 GTCCCAACAACCTCCCCTGGAGG - Intronic
1166117810 19:40666805-40666827 TTCCCGGACCCCTCCCCAGCGGG + Exonic
1166276762 19:41759137-41759159 TCCCCAGGACCTTCCCCAGGTGG + Intronic
1166388609 19:42396539-42396561 TACCCAGAACACTTGCCTGGGGG + Intergenic
1166534037 19:43560824-43560846 TTCCCAGCCCCAGCCCCTGGGGG + Intronic
1166749816 19:45159418-45159440 TTCCCTGACCCCTGCACTGGCGG - Intronic
1166814438 19:45534193-45534215 TTCGCAGAAAACTCCCTTGGAGG - Intronic
1167446791 19:49542692-49542714 TGCCCAGGACCAGCCCCTGGTGG + Exonic
1167755388 19:51409967-51409989 ATCCAAGAACCCTCTCTTGGGGG - Intergenic
1168679166 19:58301204-58301226 TTCCCTGATCCCTTTCCTGGAGG + Exonic
925425318 2:3744428-3744450 TGCCCAGAAGCATCCCCAGGTGG - Intronic
925821534 2:7803889-7803911 TCCCCACAACCCTCCCCCGCTGG + Intergenic
926440624 2:12884905-12884927 TTCCCATAGCCGTTCCCTGGAGG + Intergenic
926670860 2:15575607-15575629 TGGCCAGAACCCTTCCATGGTGG - Intergenic
927138821 2:20115893-20115915 TCCCCAGAAGCCTTCTCTGGAGG - Intergenic
927286075 2:21358400-21358422 CTCCCAGAGACCTCCCCTGAAGG + Intergenic
927499773 2:23574971-23574993 TTCCCAGGAACCTTCCCTGGGGG - Intronic
928167740 2:28982854-28982876 CTCCCAGAACCCACCCCCGTGGG + Intronic
928298590 2:30106512-30106534 TGCCCAGACCCCTCCCCTCGAGG - Intergenic
928399825 2:30969712-30969734 TTCCCAGAATCCTGGCTTGGGGG + Intronic
928801666 2:35101479-35101501 TTCCCTGAAGCCTCACTTGGAGG - Intergenic
930034238 2:47075687-47075709 TTCCCACATCCCTCCCCAGGTGG - Exonic
932714350 2:74090629-74090651 TACCCAGACCCCTGCCCTGCAGG + Intronic
934852008 2:97707485-97707507 CTCCCAGAGCTCTCCACTGGGGG + Intergenic
934887776 2:98039872-98039894 TTCACAAAAACCTCCCCTGCTGG - Intergenic
934927539 2:98392006-98392028 CTCCCGGAACACTCCCGTGGGGG - Intronic
936117422 2:109713156-109713178 TTCCAGGAACCCTGCTCTGGAGG - Intergenic
936566292 2:113584491-113584513 TTCCCAGAACCCGGCCGGGGCGG - Intergenic
936941186 2:117886171-117886193 TTCCTAAAGCCCTTCCCTGGAGG + Intergenic
938112396 2:128577729-128577751 TTCCCAGAACCCAGCCATGCTGG + Intergenic
938248662 2:129797466-129797488 TTCCCAGAGCACACCCTTGGGGG + Intergenic
938263708 2:129911932-129911954 TTGCCCGGACCCTCCCCGGGTGG - Intergenic
940510401 2:154606957-154606979 TACCCAGCACCATCTCCTGGAGG + Intergenic
946106358 2:217373553-217373575 TTCCCACAGCCTTGCCCTGGAGG + Intronic
946192170 2:218013410-218013432 TTCCCTGATCCCTCCCTAGGGGG - Intergenic
946676825 2:222169218-222169240 TTCCCAGACCCCTCCCCAGTGGG - Intergenic
948181348 2:235983278-235983300 TGCCCAGACCCCTGCCCCGGTGG - Intronic
948258484 2:236585383-236585405 TTCCCAGAGCTTTCTCCTGGAGG + Intergenic
948402467 2:237693620-237693642 TTTCAAGAACCCTTCCCTGATGG - Intronic
949028212 2:241776022-241776044 TTCCCACAACCCCTCCCTGTCGG - Intergenic
1169558797 20:6776563-6776585 TTCCCAGAATCCCCTCCTTGAGG + Intronic
1172120674 20:32596954-32596976 TTCCCAGAACCTTCCCTCAGAGG + Intronic
1172205547 20:33160447-33160469 TTCCCAGGAGCCTCCCATAGTGG - Intergenic
1173315958 20:41943153-41943175 GTCCCAGACCCCTCCCCTAAAGG - Intergenic
1173492454 20:43494147-43494169 ATCCAAGAACCCTCTCTTGGGGG - Intergenic
1173546271 20:43900668-43900690 TGGCCAAACCCCTCCCCTGGGGG + Intergenic
1173843541 20:46174387-46174409 CTCCCCCAACCCTCCCTTGGCGG - Exonic
1173943967 20:46935220-46935242 TTCCCAGCAGGCTGCCCTGGTGG - Intronic
1174388757 20:50203932-50203954 TTCCCAGATCCCTCTCCCAGAGG + Intergenic
1174462055 20:50690124-50690146 TTTCCACATGCCTCCCCTGGGGG - Intronic
1174582133 20:51579508-51579530 TTCCCAGGCCCCTCTCCTGAAGG + Intergenic
1175278412 20:57787428-57787450 TGCCCATCACTCTCCCCTGGGGG - Intergenic
1175472400 20:59240009-59240031 TTCCCTGAATCCTCCCCTGGGGG - Intronic
1175887720 20:62302234-62302256 CTCCCAGATCCCTCCCCTCCGGG + Intronic
1175887760 20:62302316-62302338 CTCCCAGATCCCTCCCCTCCAGG + Intronic
1176042802 20:63074064-63074086 TTCCCTGAAGCCTCCGCAGGGGG + Intergenic
1176138424 20:63535059-63535081 TTCTCAGACTCCTCCCCTGCAGG - Exonic
1176200416 20:63857906-63857928 ATCCCAGTACACACCCCTGGGGG - Intergenic
1176288652 21:5032994-5033016 TTCCCAGAACCCCCCAAGGGTGG + Intronic
1178588732 21:33891538-33891560 ACCCCAGAATACTCCCCTGGAGG - Exonic
1179332824 21:40421855-40421877 TTCTAAGCACCCTCCCCTGCAGG - Intronic
1179868532 21:44230481-44230503 TTCCCAGAACCCCCCAAGGGTGG - Intronic
1180078444 21:45475152-45475174 TGGCCAGAGCCCTGCCCTGGAGG - Intronic
1180920566 22:19519586-19519608 CTCCCAGAGCCCTAGCCTGGAGG + Intronic
1181498574 22:23302334-23302356 ATCCCAGACCCCTGCCCTTGGGG + Intronic
1182074861 22:27488522-27488544 GACCCAGACCCCACCCCTGGCGG + Intergenic
1182276935 22:29195687-29195709 GTGCCAGATCCCTCCTCTGGGGG + Intergenic
1183230592 22:36579612-36579634 TGCTCAGAACCCACCCGTGGTGG + Intronic
1183760266 22:39810165-39810187 TTCCCCTAAGCCTCCCCTAGAGG + Intronic
1184176910 22:42793918-42793940 CTCCCACAACCCTCCCCTCAGGG + Intergenic
1184741346 22:46430595-46430617 TTCCCCAAAACCTTCCCTGGTGG + Intronic
950104648 3:10380348-10380370 TTCTCAGACCCCTCCCAAGGGGG - Intronic
950520427 3:13494810-13494832 ATGACAGAAGCCTCCCCTGGTGG + Intronic
950869515 3:16216656-16216678 TTCCCTGATTCTTCCCCTGGCGG + Intronic
952511710 3:34064627-34064649 TTCCCATCAGCCTCCCCTCGTGG - Intergenic
952931815 3:38366291-38366313 TACCCCGATCCCTCACCTGGTGG + Intronic
953232137 3:41074685-41074707 TTCCCAGAACCCTCATCTCAGGG + Intergenic
953921324 3:46954036-46954058 TTGGAAGACCCCTCCCCTGGTGG + Intronic
954936242 3:54329484-54329506 TTTCCAGAATCCTCCACTGTCGG + Intronic
955471090 3:59287081-59287103 TTTCCAGATCCCACTCCTGGGGG - Intergenic
955664117 3:61332313-61332335 TAACCAGAACCATCCCATGGTGG + Intergenic
960013362 3:112857717-112857739 TCACCAGAAACCACCCCTGGTGG - Intergenic
960173298 3:114488168-114488190 TTCCCACAACACTCCCCTGAAGG + Intronic
961141432 3:124559760-124559782 TCCCCAGCACCCTCCCTTGTTGG + Intronic
961513646 3:127419761-127419783 TTCCCTGAGCCCTCACCTTGGGG - Intergenic
962754846 3:138459289-138459311 TTCCCTGATCCCCACCCTGGGGG - Intronic
965600419 3:170448632-170448654 GGCCCAGCACCCTCCCTTGGAGG - Intronic
966059778 3:175740874-175740896 ATCCAAGAACCCTCTCTTGGGGG + Intronic
968041909 3:195595957-195595979 TTCCCAGAACCCTCTGCTGTAGG + Intergenic
968210174 3:196842345-196842367 GTCCAAGAACCCTCTCCTGGGGG - Intergenic
968289713 3:197529091-197529113 TCCCCAGAACCCTCCCCAGACGG + Intronic
968750954 4:2388808-2388830 CACCCAGACCCCTCCCCTGCTGG + Intronic
968966867 4:3773247-3773269 TCCCCAAAGCCCTCCTCTGGAGG - Intergenic
968977420 4:3829281-3829303 CTCCCAGAACCTTCCGATGGTGG + Intergenic
969336884 4:6516254-6516276 TCCCCAGAACCCTGCCCTGGGGG + Intronic
970404721 4:15751502-15751524 TTCCCAGCACCCTCCCTTTATGG - Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
975528380 4:75375722-75375744 ATCCAAGAACCCTCTCTTGGGGG + Intergenic
978083143 4:104619133-104619155 TTCCCTGAAGCCTTCCCTGAGGG - Intergenic
985611572 5:892479-892501 TGCCCAGAACCCCTCCCTCGTGG + Intronic
986405146 5:7418344-7418366 CTCCCAGAAACATCCCCAGGCGG - Intronic
990384807 5:55249959-55249981 ATCCAAGAACCCTCTCTTGGGGG + Intergenic
992234713 5:74697639-74697661 TTGCTTGAACCCTCCCCGGGTGG + Intronic
996293240 5:121879550-121879572 ATCCAAGAACCCTCTCTTGGGGG - Intergenic
997429372 5:133826936-133826958 TTCTCAGATCCCTGCCCTGCTGG - Intergenic
997621010 5:135295186-135295208 TGGCCAGGACCCTCCACTGGAGG + Intronic
997994671 5:138575920-138575942 TTCCCAGCTCCCGCTCCTGGAGG + Intergenic
998104851 5:139462005-139462027 TTCCAAGTAGCCTCCTCTGGAGG + Intronic
998373111 5:141673591-141673613 CTCCCAGCACCCACCCCTGAGGG + Exonic
998583649 5:143404320-143404342 TTCCCTGAAGCCTCCCCAGAGGG - Intronic
999126614 5:149250685-149250707 TTCCCAAGCCCCTCCCATGGGGG - Intronic
999135856 5:149318396-149318418 TCACCAGTACCCTCCTCTGGTGG + Intronic
999697847 5:154202272-154202294 TTTCAAGAACCTTCCCTTGGAGG + Intronic
999748902 5:154611584-154611606 TTCCCAACTCCCTCCCTTGGTGG - Intergenic
1000126137 5:158245751-158245773 TTCCCATACCCCTGCCTTGGTGG - Intergenic
1002418241 5:179132041-179132063 TTCCCAGGGTCCTCCCCTTGTGG - Intronic
1002778620 6:349542-349564 CTCCCAGAACCCACCCAGGGTGG + Exonic
1002963913 6:1943283-1943305 TTTCCTGACTCCTCCCCTGGTGG + Intronic
1004003638 6:11619453-11619475 TTCCCAGAACCTTCTGCTGTGGG + Intergenic
1004281036 6:14280191-14280213 TTCCCAGAACCCAGCCATGCTGG - Intergenic
1004701944 6:18087616-18087638 TTCCCAGGACCCAACCCTGCAGG + Intergenic
1005952365 6:30641444-30641466 TCCACAGCACCCTCCCCTGCAGG - Intronic
1006147303 6:31967371-31967393 TTCCCATCACCCTCACCTGTAGG - Exonic
1006360349 6:33584030-33584052 TTCCCAGAGGCGTCCCCTGCTGG - Intergenic
1006737826 6:36287258-36287280 TCCTCAGAAACCTCCCCTGAGGG - Intronic
1007294879 6:40814109-40814131 TTCCCAGCACCCATGCCTGGGGG - Intergenic
1007305301 6:40899300-40899322 ATCCAAGAACCCTCTCTTGGGGG + Intergenic
1009698555 6:67142994-67143016 TTCCCTGAACCCCCCCTTGTAGG - Intergenic
1013014600 6:106149919-106149941 TGCTCAGATCCCACCCCTGGGGG + Intergenic
1017177486 6:151518447-151518469 ATCCAAGAACCCTCTCTTGGGGG - Intronic
1018081449 6:160262483-160262505 GCCCCAGACTCCTCCCCTGGAGG - Intronic
1018459569 6:163985131-163985153 TTCCCAGAAAACTGACCTGGTGG + Intergenic
1018997258 6:168719314-168719336 TGGCGGGAACCCTCCCCTGGTGG - Intergenic
1018997271 6:168719358-168719380 TGGCGGGAACCCTCCCCTGGTGG - Intergenic
1019494219 7:1330069-1330091 ATCCCAGGCCCCTGCCCTGGGGG + Intergenic
1020139855 7:5606309-5606331 GTCTCAGCACCCTCCCCAGGGGG + Exonic
1020860013 7:13480387-13480409 TTTCAAGAACCCTCCCATCGTGG + Intergenic
1021230977 7:18086488-18086510 TTCCCTGGTCCTTCCCCTGGGGG + Intergenic
1021690011 7:23222517-23222539 TCCCAAGGACCCTCTCCTGGAGG + Intergenic
1021937017 7:25640971-25640993 TTCCTAAAACTCTCCCCGGGAGG + Intergenic
1022444778 7:30460919-30460941 TTCCCTGAATCTTCTCCTGGAGG - Intronic
1022688458 7:32619617-32619639 TTCCCAGGACTCTTCCCTGAGGG - Intergenic
1023916356 7:44592251-44592273 TTGCCAGACCCCTTCCCTGCTGG - Intergenic
1024723076 7:52159998-52160020 TTCCCTGATCCCTCTCTTGGTGG + Intergenic
1026670211 7:72383651-72383673 TTCCCAGAACACTTCCTTAGAGG - Intronic
1027530428 7:79323956-79323978 TTCCCAGGAGCATCCCCAGGAGG - Intronic
1028481422 7:91310474-91310496 TTCTCAGAGCCCTCCAATGGTGG + Intergenic
1028697512 7:93732472-93732494 TTCCCAGGACCCTTGCCTGAAGG + Intronic
1029465073 7:100720440-100720462 CTCCCGGACACCTCCCCTGGGGG - Intergenic
1033186381 7:139231046-139231068 ACCCCAGAACCCTCCCTTTGAGG + Intronic
1033546951 7:142409894-142409916 ATCCAAGAACCCTCTCTTGGCGG - Intergenic
1033864947 7:145678170-145678192 TTCCAAGAACCCTCTCTCGGAGG + Intergenic
1034074739 7:148220927-148220949 TTCTCAGGTCCCTCCCCAGGAGG + Intronic
1035382766 7:158450256-158450278 CTCCCAGCACCATCCCCTGGGGG + Intronic
1037736311 8:21569720-21569742 ATCCAAGAACCCTCTCTTGGGGG - Intergenic
1042155481 8:65841160-65841182 TCCCCAAAACCCCACCCTGGTGG - Intronic
1043116051 8:76255177-76255199 CTACCAGAACATTCCCCTGGAGG + Intergenic
1045009204 8:97943266-97943288 TCCCCACAACCATCCTCTGGAGG + Intronic
1046476248 8:114748048-114748070 TTCCCAGAACCTATCACTGGGGG - Intergenic
1048192557 8:132302961-132302983 TTCCCAGCATGCTCCCCAGGAGG - Intronic
1048203849 8:132400039-132400061 TTCCAGGAAGCCTTCCCTGGTGG - Intronic
1048334442 8:133492187-133492209 TTCCCAGAGCCTGTCCCTGGGGG + Intronic
1048746899 8:137624625-137624647 TTCCCTGTTCCCTGCCCTGGAGG + Intergenic
1048874752 8:138827951-138827973 TTCCCAGAACCCTGTTGTGGAGG - Intronic
1049158135 8:141079597-141079619 TTTCCCGGTCCCTCCCCTGGAGG + Intergenic
1049989881 9:980876-980898 GTCCGAGGACACTCCCCTGGAGG - Intronic
1052211121 9:25904781-25904803 TTACCAGAACCCACCCATGCTGG - Intergenic
1053099892 9:35362968-35362990 TTCCCAGAACTATGCCTTGGAGG + Intronic
1053447571 9:38164703-38164725 ATCCCAGCACCCTCCCCTCCAGG + Intergenic
1053484899 9:38445068-38445090 TCCCCAGAATCCTGCCTTGGAGG - Intergenic
1055372171 9:75611750-75611772 TTCCCTGAGCCCTTCCCTGTGGG - Intergenic
1055846351 9:80568396-80568418 TTCCCAGAATCCTCTGCTGATGG - Intergenic
1056187868 9:84154216-84154238 TTCCAAGAACCGTCTCCTGGTGG - Intergenic
1057046970 9:91893490-91893512 TCCCCACACCCCTCCACTGGGGG + Intronic
1057299461 9:93869529-93869551 TTTCCAAATCCCTCCCCAGGAGG - Intergenic
1057819609 9:98321127-98321149 TTCCCAGGACTCGGCCCTGGGGG + Intronic
1059469811 9:114496166-114496188 TTCCCAGCAACCTTCCCTGATGG - Intronic
1060253616 9:122005794-122005816 TTTCCAAAACCCTCCCTAGGTGG - Intronic
1060554270 9:124500301-124500323 TACCCAGAGCCCTTCTCTGGAGG - Exonic
1061505111 9:131027319-131027341 TTTCCAGAACTCTCCGCTGAGGG + Intronic
1061757518 9:132825706-132825728 TTCCCAGCACCTTCTCCTGCTGG - Intronic
1061866710 9:133495044-133495066 TCCCCAGGACCCTTCCATGGAGG + Intergenic
1061910746 9:133721615-133721637 GTCCCATTTCCCTCCCCTGGAGG - Intronic
1062373606 9:136252374-136252396 TTGCCTGGACCTTCCCCTGGTGG - Intergenic
1062657685 9:137612779-137612801 TTCCCAGGACCCTGCCCAGGTGG + Intronic
1185849348 X:3470736-3470758 ATCCAAGAACCCTCTCTTGGGGG + Intergenic
1188251240 X:27897567-27897589 TTCCCAGACCACTCTCCTGTAGG - Intergenic
1192730791 X:73800857-73800879 ATCCAAGAACCCTCTCCTGGGGG - Intergenic
1194690581 X:96979818-96979840 TTCCCAGACTCCTTCACTGGCGG + Intronic
1197262716 X:124334426-124334448 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG + Intronic
1198318081 X:135489626-135489648 TTGGCAGAACCCTGCCCTAGAGG + Intergenic
1199367141 X:147000454-147000476 ATCCAAGAACCCTCGCTTGGGGG - Intergenic
1199510063 X:148611764-148611786 TTCCCTGAACCCACCCGTAGTGG + Intronic
1200243161 X:154508230-154508252 TTCCCTGCTCCCTCCCCAGGAGG - Intronic