ID: 916480558

View in Genome Browser
Species Human (GRCh38)
Location 1:165210800-165210822
Sequence GTAGACACACTGGCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916480551_916480558 30 Left 916480551 1:165210747-165210769 CCCTGTCTCTGCAGCCAGAGTCT 0: 1
1: 1
2: 3
3: 33
4: 358
Right 916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 126
916480555_916480558 1 Left 916480555 1:165210776-165210798 CCTTGGAAAAATTGAACGAGAAA 0: 1
1: 0
2: 1
3: 27
4: 308
Right 916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 126
916480554_916480558 16 Left 916480554 1:165210761-165210783 CCAGAGTCTCTCTCACCTTGGAA 0: 1
1: 0
2: 2
3: 22
4: 228
Right 916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 126
916480552_916480558 29 Left 916480552 1:165210748-165210770 CCTGTCTCTGCAGCCAGAGTCTC 0: 1
1: 0
2: 3
3: 29
4: 379
Right 916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916480558 Original CRISPR GTAGACACACTGGCATCTCA GGG Intronic
901180152 1:7336214-7336236 GTAGAGCTCCTGGCATCTCAGGG - Intronic
905998832 1:42405710-42405732 GTAGACACAGTTGCATTGCAGGG + Intronic
906218926 1:44061950-44061972 GTATACACAGTAGCAGCTCAGGG - Intergenic
907492718 1:54819101-54819123 CTAGAGACACTGGCATTTGAGGG - Intronic
910835529 1:91505203-91505225 CTAGGCACACTCCCATCTCAGGG - Intronic
911400327 1:97366797-97366819 GTAGCCTCCCTGGCATCTCATGG - Intronic
913262276 1:117010262-117010284 GTGGAGACTCTGGCTTCTCAGGG - Intronic
913400387 1:118425401-118425423 GCAGTAACACTGGCATCACATGG - Intergenic
916480558 1:165210800-165210822 GTAGACACACTGGCATCTCAGGG + Intronic
919801544 1:201357489-201357511 GGAGACCCACTGGCAGCTCCTGG - Intergenic
922992581 1:229927360-229927382 ATCAACACACTGACATCTCAGGG - Intergenic
1070263888 10:74884015-74884037 TAAGAGACACTGGCATTTCATGG + Intronic
1070850377 10:79558274-79558296 GGAGACACACTGGAATCTCGTGG - Intronic
1070856841 10:79613022-79613044 GGAGACACACTGGAATCTTGTGG + Intronic
1073326820 10:102648015-102648037 GCCGACACACTGGCTTCCCAAGG - Intronic
1073355462 10:102850376-102850398 GTGGACAGACTGGCCGCTCAGGG - Intergenic
1074267517 10:111919405-111919427 CTACACTCTCTGGCATCTCAAGG + Intergenic
1074736893 10:116444707-116444729 GTAGACACACTGCCACCTAGTGG - Intronic
1074939330 10:118219338-118219360 GCAGCCACACTGGCCTCTCGTGG - Intergenic
1075004532 10:118820496-118820518 GTGGCCAAGCTGGCATCTCATGG + Intergenic
1075605824 10:123806979-123807001 GTAGACACGCTGCTATCACATGG - Intronic
1075871001 10:125772852-125772874 GTAGACAGAGTGGCAGCTCCTGG + Intronic
1076533272 10:131159555-131159577 GGAGACACACTGGGAGCTCCAGG - Intronic
1078397776 11:10996785-10996807 GAAGAGACAATGGCATCTGATGG - Intergenic
1080427556 11:32170219-32170241 GAAGACACTCTGAGATCTCAAGG - Intergenic
1084918174 11:72447125-72447147 GTAGAGACACTGACATCTTGTGG + Intergenic
1094681590 12:32672080-32672102 GTTGTCACACTGCCCTCTCATGG + Intergenic
1096665474 12:53161140-53161162 ACAGACACACAGGCATCTCCTGG - Exonic
1097926954 12:65139335-65139357 CTAGCCACACTGGCTCCTCAAGG + Intergenic
1098853333 12:75623967-75623989 GGAGACATACTGGCATCTAGTGG - Intergenic
1099298514 12:80861592-80861614 GTAAAGGCAGTGGCATCTCAGGG - Intronic
1101104395 12:101425679-101425701 CTAGACACACAGGCATTTCTGGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101567472 12:105921947-105921969 ATAAACACACTGGAATCACATGG + Intergenic
1101924897 12:108963443-108963465 AAAGACAGACTGGCACCTCACGG - Intronic
1102982679 12:117254518-117254540 CTGGAGACACTGGCATCTCCTGG - Intronic
1105483082 13:20797721-20797743 CTACACACACTGGCAACTCTTGG + Intronic
1114429553 14:22648644-22648666 GTAGATCTACTGGCAGCTCAGGG - Intergenic
1115868482 14:37774556-37774578 GTAAACAACCTTGCATCTCAGGG + Intronic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1124515384 15:30363047-30363069 GCAGGCACACTGCAATCTCAGGG + Intronic
1124727539 15:32167682-32167704 GCAGGCACACTGCAATCTCAGGG - Intronic
1128553702 15:68615675-68615697 GAAGACACAAGGGCCTCTCAGGG - Intronic
1128686168 15:69687292-69687314 AAAGACACACTGGCAACTCCTGG + Intergenic
1130691894 15:86088630-86088652 GCACACCCACTGGCATCCCAGGG - Intergenic
1140769528 16:78190650-78190672 GTAATCACACTGGCATGGCAGGG + Intronic
1141438918 16:84016746-84016768 ACAGACACATGGGCATCTCAGGG + Intronic
1141618149 16:85221769-85221791 CCAGACACCCTGGCATCTCGGGG + Intergenic
1143445414 17:7006331-7006353 CTAAACACACTAGCATCTCATGG - Intronic
1147967969 17:44204130-44204152 GTAGACACCCTTGCATCCCCTGG - Intergenic
1151306031 17:73263106-73263128 GTAGAAACCCTGGCTTCTCTTGG + Intergenic
1152033080 17:77855666-77855688 CTAGAGACACTGACATCCCAGGG + Intergenic
1152229447 17:79107131-79107153 TTAGCCCCACTGACATCTCAAGG + Intronic
1152342783 17:79734369-79734391 GTAGAGACCCTGGCATCACAAGG + Intronic
1152760977 17:82106912-82106934 GTGGGCACCCTAGCATCTCAGGG + Intronic
1153102286 18:1487500-1487522 GAAGAGACATGGGCATCTCAAGG + Intergenic
1155180349 18:23340024-23340046 GTAGAGAGACTGGGATTTCAGGG - Intronic
1157294667 18:46433760-46433782 GGACACACACTGGCTTCTGAGGG - Intronic
1159292849 18:66444799-66444821 CTAGAAGCATTGGCATCTCAGGG - Intergenic
1166999551 19:46737912-46737934 GCAGACACACGAGCAGCTCACGG - Intronic
925071785 2:974857-974879 GTAGACACTATGCCTTCTCATGG + Intronic
928368906 2:30724627-30724649 CTGGACACCCTGGCATCTCAAGG + Intronic
931614106 2:64138270-64138292 GTAGGCACGCTCCCATCTCAGGG + Intronic
936863133 2:117045940-117045962 GCAGACACAGTGTCAACTCAAGG + Intergenic
938192889 2:129299604-129299626 GAAGACACATTGGCAGGTCAAGG - Intergenic
939020102 2:136948373-136948395 GTAGACAAACTTGACTCTCATGG + Intronic
940507985 2:154580065-154580087 GTAGCCACATTGGCTTCTCATGG + Intergenic
944543564 2:200777482-200777504 TCAGACACACTAGCATGTCATGG + Intergenic
944972599 2:205011287-205011309 GTAGCCAAGCTGTCATCTCAAGG + Intronic
948091623 2:235300873-235300895 GCAGAAACACTGGCATCTCAGGG + Intergenic
1170898036 20:20434229-20434251 CCACACACACTGGCCTCTCATGG + Intronic
1170912242 20:20584389-20584411 GTAGAAAGACAGGCCTCTCAAGG + Intronic
1174552906 20:51374474-51374496 GTAGACCCAGTGGAATCACAAGG - Intergenic
1175300737 20:57941069-57941091 GTAGACCCGCTGCCATCACAGGG + Intergenic
1175542843 20:59758863-59758885 GTAGTCACACTGACCTCCCAGGG + Intronic
1175736793 20:61392789-61392811 GTAGAAACACTGGCCCCCCACGG + Intronic
1176237114 20:64058492-64058514 GAAGACCACCTGGCATCTCATGG + Intronic
1176252284 20:64131417-64131439 GTAGACACACTGGAGTATCCAGG + Intergenic
1176373164 21:6074585-6074607 CTGGACACACTGGCAGCTCTGGG + Intergenic
1178170139 21:30031451-30031473 GTAGAAACAAGGGCATCTCCTGG + Intergenic
1179724126 21:43332333-43332355 GTAGACACAATGACATCACTCGG + Intergenic
1179750313 21:43463658-43463680 CTGGACACACTGGCAGCTCTGGG - Intergenic
1183525680 22:38321162-38321184 GTAGCCTCACTGGCCTCCCATGG + Intronic
949921064 3:9000880-9000902 CCAAACCCACTGGCATCTCAGGG + Intronic
952952777 3:38538340-38538362 GTGGACACACTGACATTTGAAGG - Intronic
953224593 3:41005951-41005973 GGAGACATCCTTGCATCTCAGGG + Intergenic
953267303 3:41403849-41403871 GTAAACACACTGATAACTCATGG - Intronic
953399087 3:42597157-42597179 ATAGACACACTGGACTCTCAGGG + Intronic
957086035 3:75678043-75678065 ATAGACAAACTCGTATCTCAGGG + Intergenic
959014894 3:101122665-101122687 GTAAACACAGTGTCATCTCATGG + Intergenic
962920192 3:139943565-139943587 GTAGACACCCCAGGATCTCAAGG - Intronic
963517502 3:146326654-146326676 GGAATCACACTGGCATCTCTTGG + Intergenic
967106876 3:186261292-186261314 GTGGATGCACTGGCTTCTCACGG + Intronic
968075043 3:195811758-195811780 GCAGAGACACAGGCAGCTCAGGG + Exonic
972486534 4:39546234-39546256 GTAGACAATTTGGCATCTGATGG + Intergenic
976838739 4:89406653-89406675 GTAGACAAACTGGGGTCTCAAGG - Intergenic
978792056 4:112672795-112672817 GAAGACACACTCACACCTCAGGG - Intergenic
981195218 4:141911798-141911820 ATAGGCACACTGGCACCTCTGGG - Intergenic
985755104 5:1709160-1709182 ACATACACACTGGCATCCCACGG + Intergenic
986775257 5:11008319-11008341 GTAGGCCCAATGTCATCTCAAGG + Intronic
989536898 5:42574330-42574352 GTTGACAAACTGGTATATCATGG + Intronic
990375718 5:55168423-55168445 GGATACACACTGGGATGTCAAGG - Intronic
992325711 5:75657579-75657601 CTAGACACACTGCCATTTGAAGG + Intronic
1005421705 6:25657844-25657866 GAAGACAGACTGTCACCTCAGGG + Intronic
1007044243 6:38756356-38756378 GTAGACACACTCCTATCTCTTGG - Intronic
1007370009 6:41420536-41420558 GATGCCACACTGGCTTCTCATGG - Intergenic
1010134504 6:72534757-72534779 GCAGACACAAAGGCATCTCAGGG + Intergenic
1010938615 6:81889382-81889404 CTAGCCACACTGGCAGCTGAGGG + Intergenic
1020871909 7:13641127-13641149 ATAGACACTCTGGGTTCTCACGG + Intergenic
1021811872 7:24410235-24410257 GTAGAGACACTAGAAGCTCATGG + Intergenic
1024638059 7:51306822-51306844 GCAGGCACACTGGCTTTTCATGG + Intronic
1024661760 7:51502064-51502086 GTGGAGACAGTGGTATCTCAGGG - Intergenic
1025112940 7:56234819-56234841 GTAGCCACACGGGATTCTCACGG - Intergenic
1029968133 7:104762075-104762097 GGTGACACACTGGCATCGCTGGG - Intronic
1032514607 7:132497396-132497418 GTAAACACGATGTCATCTCAAGG - Intronic
1034037495 7:147839643-147839665 GTTGTCACACTAGCACCTCATGG - Intronic
1035424621 7:158761061-158761083 GTAGAGACAGTGGGAACTCATGG - Intronic
1035682729 8:1500289-1500311 GTAGACACAGCTGGATCTCAGGG - Intergenic
1036149804 8:6286736-6286758 GTAGAGCCCCTGGCAGCTCATGG - Intergenic
1038897636 8:31803873-31803895 GAAGACACATTTCCATCTCAGGG + Intronic
1039135384 8:34316870-34316892 GTAGACCCAATGTAATCTCAAGG - Intergenic
1045296061 8:100872516-100872538 GAAGACACATGGGCATCCCAAGG - Intergenic
1045962091 8:107980171-107980193 GGTGACACACTGGCTGCTCAGGG - Intronic
1047311992 8:123699704-123699726 ATAGACAAGCTGGCATTTCAAGG + Intronic
1048423882 8:134304645-134304667 ATAGAAACACTGTCATCTCTAGG - Intergenic
1049143698 8:140981434-140981456 GAACACACACTGGCCTTTCAAGG + Intronic
1051001887 9:12292239-12292261 GTAAAGACACTGGAAACTCAGGG - Intergenic
1053604405 9:39642132-39642154 GAAGAGACACTGGCATTTCGAGG + Intergenic
1054249136 9:62700282-62700304 GAAGAGACACTGGCATTTCAAGG - Intergenic
1054563249 9:66734815-66734837 GAAGAGACACTGGCATTTCGAGG - Intergenic
1055440421 9:76331337-76331359 GTAGACCCAATGCCATCACAAGG + Intronic
1056551415 9:87656177-87656199 GCAGACACACTGGCTTCCCTTGG - Intronic
1062470070 9:136698667-136698689 GAAGACCCACAGGGATCTCACGG + Intergenic
1189385073 X:40530583-40530605 GTACCCACACTCTCATCTCAGGG + Intergenic
1194561623 X:95428389-95428411 GTGGAAAAAATGGCATCTCATGG + Intergenic
1195402965 X:104481370-104481392 GAAAACACACTGGCAGGTCAGGG + Intergenic
1198175055 X:134146726-134146748 GTTGACACTCTGTCATCTCCTGG + Intergenic
1198995049 X:142565087-142565109 GGAACCACACTTGCATCTCAGGG + Intergenic
1199995836 X:153025643-153025665 GTAGACACATTGGAATCTGTAGG + Intergenic