ID: 916481450

View in Genome Browser
Species Human (GRCh38)
Location 1:165218327-165218349
Sequence GGATGCCCAAAATTCCACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916481450_916481456 22 Left 916481450 1:165218327-165218349 CCAATGTGGAATTTTGGGCATCC 0: 1
1: 0
2: 2
3: 9
4: 90
Right 916481456 1:165218372-165218394 TTCTGAAGATGGAGGAACAGAGG 0: 1
1: 0
2: 5
3: 57
4: 519
916481450_916481455 14 Left 916481450 1:165218327-165218349 CCAATGTGGAATTTTGGGCATCC 0: 1
1: 0
2: 2
3: 9
4: 90
Right 916481455 1:165218364-165218386 CAGAAAGATTCTGAAGATGGAGG 0: 1
1: 0
2: 1
3: 38
4: 312
916481450_916481453 11 Left 916481450 1:165218327-165218349 CCAATGTGGAATTTTGGGCATCC 0: 1
1: 0
2: 2
3: 9
4: 90
Right 916481453 1:165218361-165218383 AGCCAGAAAGATTCTGAAGATGG 0: 1
1: 0
2: 0
3: 30
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916481450 Original CRISPR GGATGCCCAAAATTCCACAT TGG (reversed) Intronic
902734121 1:18388781-18388803 AGCTGCCCAAGATCCCACATTGG - Intergenic
914512983 1:148351230-148351252 GGATGCCCAAACTTACCCAAAGG - Intergenic
915157777 1:153892582-153892604 GAATGTCCAGAATTTCACATTGG - Intronic
916481450 1:165218327-165218349 GGATGCCCAAAATTCCACATTGG - Intronic
921909801 1:220535777-220535799 GGATGCCAAAAATTCACAATGGG - Intronic
923556517 1:235004966-235004988 GTCTGCCCAAAATTCCACTCAGG + Intergenic
923603548 1:235423695-235423717 GGCTGCCGAAAATTCCAGACCGG - Intronic
924213092 1:241790871-241790893 GGAGGCCAAAAGTTCTACATGGG + Intronic
1068257906 10:54537687-54537709 GAATCTCCAAATTTCCACATTGG + Intronic
1068440292 10:57045889-57045911 GGATGCCCCAAGGTCTACATTGG - Intergenic
1068647498 10:59484410-59484432 GGATGACCAAAAGTCCCCCTTGG - Intergenic
1075314270 10:121439450-121439472 GAAAGCCCAAAATTCCCCTTGGG + Intergenic
1078664075 11:13310033-13310055 GAAGGCCCAGGATTCCACATTGG - Exonic
1086517949 11:87635731-87635753 AGATGCTCAAAACTCCACAGGGG - Intergenic
1087420718 11:97922368-97922390 GTATGCCCCAAATCCTACATAGG - Intergenic
1088166177 11:106940298-106940320 AGATCCACAAATTTCCACATAGG + Intronic
1090857868 11:130626043-130626065 AGATGCCAACAATTCCACAGAGG - Intergenic
1092882862 12:12901357-12901379 GGCTGCCAAAAATTGCACTTTGG - Intronic
1097720379 12:63013409-63013431 AGATGCTCAAAGTTTCACATAGG - Intergenic
1100723665 12:97386128-97386150 GGAAGCCCAGCATTCCACACTGG + Intergenic
1101857685 12:108457471-108457493 GGATGGCCAACAATGCACATAGG + Intergenic
1104877153 12:132043333-132043355 GGATGCCCAGAAGTCCGCACAGG + Exonic
1106971795 13:35149701-35149723 AGATGCTCAAAAATTCACATAGG - Intronic
1107821219 13:44287352-44287374 GTATACTCAAAATCCCACATGGG + Intergenic
1112078785 13:95943228-95943250 AAATCCCCAAAATTCCACTTTGG + Intronic
1115773433 14:36689546-36689568 GGAAGCCCTAATTTCCACAGGGG + Intronic
1117746652 14:58876227-58876249 GGAAGCCCAAAGTGCCACTTTGG - Intergenic
1118387825 14:65271288-65271310 GGATGCTCACCATTCCACACTGG + Intergenic
1119104424 14:71910760-71910782 AGATGCCCAAATTTCCAGCTTGG + Intergenic
1119250712 14:73151162-73151184 GAATGCCCAAAATTCTACATAGG - Intronic
1121159161 14:91719286-91719308 GTATGCCCCAAATACCACATGGG + Intronic
1123195006 14:106607558-106607580 GGATGTGCAATATTGCACATTGG + Intergenic
1126436230 15:48641248-48641270 GGATGCCTAAATTTCCACTGTGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1137231872 16:46574117-46574139 GAATGCCTAAAAATCCACTTAGG + Intergenic
1140720966 16:77771773-77771795 AGATGCCCAAAAATACAGATGGG + Intergenic
1143626352 17:8112305-8112327 AGATGCCTAACAATCCACATGGG + Intronic
1144613000 17:16741383-16741405 GGTTGCCCAAATATCTACATTGG + Intronic
1145132661 17:20371460-20371482 GGTTGCCCAAATATCTACATTGG + Intergenic
1147050499 17:37790760-37790782 GGATGACCAAATTACCACGTGGG - Intergenic
1153804527 18:8700888-8700910 TGATTGCCAAAATGCCACATGGG - Intergenic
1156513602 18:37661539-37661561 GGAGGCCCAAAATTCCAGAAAGG - Intergenic
1157401310 18:47390789-47390811 GGATGCCCTAAATCACACAGTGG - Intergenic
1157680051 18:49598073-49598095 GGCTGCCCCAAATTCCATATAGG + Exonic
1158624879 18:59062492-59062514 GGTTGCACAAATTTGCACATGGG - Intergenic
1160161479 18:76475464-76475486 CCATCCCCAAAATTCCACCTCGG + Intronic
1160328603 18:77972076-77972098 GGATGGGCAAAATTCACCATGGG - Intergenic
1162865157 19:13540353-13540375 GGGTGCCCAACATCCCACATGGG + Intronic
1163677195 19:18660977-18660999 GGGTGTCCTAAATTCCAGATGGG + Intronic
1167302156 19:48684315-48684337 GGGTGCCTAAAATCCCACTTGGG - Intergenic
925647880 2:6055405-6055427 GGATGTCCAGAAGTCCACAGTGG - Intergenic
925650767 2:6086890-6086912 GGATGCCCAGGCTTCCACTTTGG - Intergenic
926427831 2:12755439-12755461 GTATTCCCAGAAGTCCACATGGG + Intergenic
930979185 2:57501260-57501282 GCATGTTAAAAATTCCACATGGG - Intergenic
934673499 2:96232227-96232249 GGATGACCAATATTCTACAGTGG - Intergenic
935945391 2:108281545-108281567 GGATGAGCAAACTTCCACAGAGG + Intergenic
938643364 2:133306087-133306109 GGATCCACAAAATTCCCCCTAGG - Intronic
940146597 2:150551717-150551739 TGATGCCTGAAATTCCATATTGG - Intergenic
945815493 2:214600554-214600576 GGATGCCCAATATTTTACAGAGG - Intergenic
1168967970 20:1911508-1911530 GGCTGCCTGTAATTCCACATAGG + Intronic
1170301371 20:14887937-14887959 TGTTGCCAAAAATTGCACATAGG + Intronic
1170303303 20:14909951-14909973 GCATGCCCAAGAATCTACATTGG - Intronic
1170336903 20:15280529-15280551 CAATGTCCATAATTCCACATTGG - Intronic
1182102636 22:27668870-27668892 GGTTCCCCAAGCTTCCACATGGG + Intergenic
953293911 3:41694128-41694150 GGAAGCCAAAACTTCCACAAAGG + Intronic
955359016 3:58256842-58256864 GCATTCCCAAAATTCCAAACAGG - Intronic
955829140 3:62982938-62982960 GGAAGCCCAGCATTCCACATAGG + Intergenic
957500266 3:81047326-81047348 GGATGCCCAACCTCCCACATAGG + Intergenic
957755706 3:84483800-84483822 GAATGTCCAAAATTATACATGGG + Intergenic
963834471 3:150042852-150042874 GGATCCCCAATATTGCAGATGGG + Intronic
973181733 4:47276976-47276998 GGATCCCCAAAATAAAACATAGG + Intronic
974901174 4:68000395-68000417 GGCTCACCAAAACTCCACATTGG - Intergenic
975984471 4:80189792-80189814 GAAAGCCCACAATTCCACAGGGG - Intronic
986062289 5:4202896-4202918 GGATGCTCCAAAGTCCCCATAGG - Intergenic
987221018 5:15790729-15790751 CGATGCCCATCATTCCACCTGGG - Intronic
988424407 5:31046933-31046955 AGATGCCAAAACTTCTACATGGG + Intergenic
990446341 5:55897250-55897272 TGATGCCCCAAATCTCACATTGG + Intronic
1011601423 6:89063885-89063907 GGAGGCCCAATATTTCAAATAGG - Intergenic
1017566290 6:155691072-155691094 GGATGCTCAAAATTAAGCATGGG + Intergenic
1018042177 6:159934491-159934513 GGATGCCCACAATTCCATGAAGG - Intergenic
1020592775 7:10163632-10163654 TAATGTCCAAAATTACACATTGG + Intergenic
1020934934 7:14450974-14450996 AGATGCCCAAAATATCAGATGGG + Intronic
1028240240 7:88410873-88410895 GGAGGCCCAAAATTACATAAAGG - Intergenic
1030886233 7:114941475-114941497 GGATTTCCAAAAGTCCAGATGGG - Intronic
1032718907 7:134534788-134534810 GGTTTCCCAAAATTTCAGATGGG - Intronic
1036163448 8:6409288-6409310 GGATGACCACACTTCAACATAGG - Exonic
1036631738 8:10520753-10520775 AGATGCCCAAACTGCTACATTGG + Intergenic
1039628961 8:39087847-39087869 GGAAGCCAAAAGTTACACATGGG - Intronic
1040625452 8:49144164-49144186 GGATGCACATCATTCCACATTGG + Intergenic
1044222734 8:89688295-89688317 AAATTTCCAAAATTCCACATTGG - Intergenic
1045825398 8:106391330-106391352 TCATGCCCAAAATTTCACATTGG - Intronic
1049081873 8:140449647-140449669 GGATGCCAGAAATACCACCTGGG - Intronic
1186799452 X:13078685-13078707 GGATGCCCTAAACTCCACATTGG + Intergenic
1188810312 X:34646113-34646135 GGTTGTCCAAAATGCCAGATGGG + Intronic
1188999707 X:36930852-36930874 GGCTTCCCAAAATTCAACAAGGG + Intergenic
1189896576 X:45663087-45663109 GGAAGCCTAAAATTCAACATAGG + Intergenic
1190009288 X:46769585-46769607 AGATGACCAAGAATCCACATGGG - Intergenic
1190107772 X:47571816-47571838 GGACCCCCCAAAATCCACATGGG - Exonic
1190906204 X:54730842-54730864 TGATGCCCAAAATCTCACCTCGG - Intergenic
1196288305 X:113908823-113908845 TGATGCCCAAAGTTCCTCCTTGG + Intergenic
1199527486 X:148808679-148808701 AGAGGCCCAAAATCCCAAATAGG - Intronic
1201255986 Y:12108707-12108729 GGATGCCCAGAGTCCCACCTGGG - Intergenic