ID: 916483403 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:165235667-165235689 |
Sequence | GGCCTCGCCTCCGCCCGCGC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 255 | |||
Summary | {0: 1, 1: 1, 2: 1, 3: 29, 4: 223} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
916483397_916483403 | 0 | Left | 916483397 | 1:165235644-165235666 | CCGGGACGACCTCGCCGCGACCT | 0: 1 1: 0 2: 0 3: 3 4: 44 |
||
Right | 916483403 | 1:165235667-165235689 | GGCCTCGCCTCCGCCCGCGCGGG | 0: 1 1: 1 2: 1 3: 29 4: 223 |
||||
916483399_916483403 | -9 | Left | 916483399 | 1:165235653-165235675 | CCTCGCCGCGACCTGGCCTCGCC | 0: 1 1: 0 2: 0 3: 23 4: 245 |
||
Right | 916483403 | 1:165235667-165235689 | GGCCTCGCCTCCGCCCGCGCGGG | 0: 1 1: 1 2: 1 3: 29 4: 223 |
||||
916483396_916483403 | 1 | Left | 916483396 | 1:165235643-165235665 | CCCGGGACGACCTCGCCGCGACC | 0: 1 1: 0 2: 0 3: 4 4: 35 |
||
Right | 916483403 | 1:165235667-165235689 | GGCCTCGCCTCCGCCCGCGCGGG | 0: 1 1: 1 2: 1 3: 29 4: 223 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
916483403 | Original CRISPR | GGCCTCGCCTCCGCCCGCGC GGG | Intronic | ||