ID: 916483403

View in Genome Browser
Species Human (GRCh38)
Location 1:165235667-165235689
Sequence GGCCTCGCCTCCGCCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916483397_916483403 0 Left 916483397 1:165235644-165235666 CCGGGACGACCTCGCCGCGACCT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 916483403 1:165235667-165235689 GGCCTCGCCTCCGCCCGCGCGGG 0: 1
1: 1
2: 1
3: 29
4: 223
916483399_916483403 -9 Left 916483399 1:165235653-165235675 CCTCGCCGCGACCTGGCCTCGCC 0: 1
1: 0
2: 0
3: 23
4: 245
Right 916483403 1:165235667-165235689 GGCCTCGCCTCCGCCCGCGCGGG 0: 1
1: 1
2: 1
3: 29
4: 223
916483396_916483403 1 Left 916483396 1:165235643-165235665 CCCGGGACGACCTCGCCGCGACC 0: 1
1: 0
2: 0
3: 4
4: 35
Right 916483403 1:165235667-165235689 GGCCTCGCCTCCGCCCGCGCGGG 0: 1
1: 1
2: 1
3: 29
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916483403 Original CRISPR GGCCTCGCCTCCGCCCGCGC GGG Intronic