ID: 916485321

View in Genome Browser
Species Human (GRCh38)
Location 1:165253696-165253718
Sequence GAGGAGAAGCATATCGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916485321_916485331 26 Left 916485321 1:165253696-165253718 CCTATCTCGATATGCTTCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 916485331 1:165253745-165253767 AAATTGGGGGATAGTCCAAGGGG 0: 1
1: 0
2: 2
3: 14
4: 154
916485321_916485332 30 Left 916485321 1:165253696-165253718 CCTATCTCGATATGCTTCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 916485332 1:165253749-165253771 TGGGGGATAGTCCAAGGGGTTGG 0: 1
1: 0
2: 0
3: 11
4: 152
916485321_916485326 11 Left 916485321 1:165253696-165253718 CCTATCTCGATATGCTTCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 916485326 1:165253730-165253752 TTCAGAAAGGAAGTGAAATTGGG 0: 1
1: 0
2: 5
3: 54
4: 510
916485321_916485328 13 Left 916485321 1:165253696-165253718 CCTATCTCGATATGCTTCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 916485328 1:165253732-165253754 CAGAAAGGAAGTGAAATTGGGGG 0: 1
1: 1
2: 3
3: 55
4: 521
916485321_916485325 10 Left 916485321 1:165253696-165253718 CCTATCTCGATATGCTTCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 916485325 1:165253729-165253751 CTTCAGAAAGGAAGTGAAATTGG 0: 1
1: 1
2: 3
3: 48
4: 458
916485321_916485327 12 Left 916485321 1:165253696-165253718 CCTATCTCGATATGCTTCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 916485327 1:165253731-165253753 TCAGAAAGGAAGTGAAATTGGGG 0: 1
1: 0
2: 4
3: 51
4: 497
916485321_916485329 24 Left 916485321 1:165253696-165253718 CCTATCTCGATATGCTTCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 916485329 1:165253743-165253765 TGAAATTGGGGGATAGTCCAAGG 0: 1
1: 0
2: 0
3: 23
4: 171
916485321_916485330 25 Left 916485321 1:165253696-165253718 CCTATCTCGATATGCTTCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 916485330 1:165253744-165253766 GAAATTGGGGGATAGTCCAAGGG 0: 1
1: 0
2: 0
3: 9
4: 105
916485321_916485323 -2 Left 916485321 1:165253696-165253718 CCTATCTCGATATGCTTCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 141
Right 916485323 1:165253717-165253739 TCTGCCTCTCAGCTTCAGAAAGG 0: 1
1: 0
2: 4
3: 32
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916485321 Original CRISPR GAGGAGAAGCATATCGAGAT AGG (reversed) Intronic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
904970170 1:34413339-34413361 GAGGAGAAGAATTTTGGGATGGG - Intergenic
905653974 1:39674176-39674198 GATGAGCAGCAGATCAAGATGGG + Intergenic
908390591 1:63679951-63679973 GAGGAGAAGCAAAAAGAGAAGGG - Intergenic
909609097 1:77534319-77534341 TAAGAGAAGGATATGGAGATGGG + Intronic
910362739 1:86430474-86430496 GGAAAGAAGCATATCCAGATAGG - Intronic
911831404 1:102554684-102554706 GAGGAGAAGCAGCTAGACATCGG + Intergenic
912582070 1:110729832-110729854 GAGGAGAAGCATCTGGATGTTGG + Intergenic
913439048 1:118878044-118878066 TAGGAAAAGCAGATTGAGATTGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916485321 1:165253696-165253718 GAGGAGAAGCATATCGAGATAGG - Intronic
923313938 1:232761054-232761076 GGGGAGTAACATAGCGAGATAGG - Intergenic
923397778 1:233584050-233584072 GAGGAGAAGCAGCTGGACATTGG + Intergenic
1067468385 10:46518301-46518323 GATGAGAATCCTATAGAGATAGG - Intergenic
1073997015 10:109327073-109327095 TAGGAGAAGCATATATAGACAGG - Intergenic
1075978955 10:126720864-126720886 GAGGAGAAGACTATGGAGGTTGG + Intergenic
1077803016 11:5560992-5561014 GAGGACAAACATATCATGATTGG - Intronic
1078184706 11:9041864-9041886 GAGGAGAAGAATTCTGAGATGGG + Intronic
1078370126 11:10737376-10737398 GAGCATCAGCATTTCGAGATGGG - Intergenic
1079180442 11:18189039-18189061 GCGGACAAGCAGATCGAGACTGG + Exonic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1083269688 11:61565570-61565592 GAGGAAAAACAAATTGAGATAGG + Intronic
1084466741 11:69327794-69327816 GAGGAGAAGCTTCCCAAGATGGG - Intronic
1088438272 11:109840001-109840023 GAGGAGAAGTATGTAGATATGGG + Intergenic
1088944313 11:114494293-114494315 GAGGAGGTGGATAACGAGATAGG - Intergenic
1090357884 11:126152220-126152242 CAGGAGAAGAATATAGAGAAAGG - Intergenic
1090358434 11:126156177-126156199 GAGGAGAAAGACATGGAGATCGG - Intergenic
1092952927 12:13524937-13524959 GAGGAGTAACATATTAAGATAGG + Intergenic
1102053595 12:109880313-109880335 GCGGACAAGCAGATCGAGACCGG - Exonic
1104554889 12:129790551-129790573 GAGGAGAAGCAGCTGGACATCGG - Intronic
1104859488 12:131917041-131917063 CAGGAGAAGCCCATGGAGATCGG + Exonic
1106814853 13:33396290-33396312 GAGGAGAAGCACATCTTGGTTGG - Intergenic
1115245182 14:31287395-31287417 GAGGAGAAGCAGCTGGACATAGG - Intergenic
1119521280 14:75287711-75287733 GAGGAGAAGCAGGTAGAAATAGG + Intergenic
1122641673 14:103163646-103163668 GAGGAGAAGCAGCTGGACATTGG + Intergenic
1124854147 15:33370847-33370869 GAGCAGTAGCATTTAGAGATGGG + Intronic
1130334900 15:82950324-82950346 GAGGAGAAGCATCTCAAGTTGGG + Intronic
1132663422 16:1071406-1071428 GAGGGGCAGCAGATGGAGATGGG + Intergenic
1132825438 16:1902876-1902898 GGGGAGAAGCATCTGGAGACTGG - Intergenic
1133825652 16:9275854-9275876 GAGGAGAAGCATTTCCAGAAGGG + Intergenic
1134910992 16:18026252-18026274 GAGGAGAATCATATGAAGTTTGG + Intergenic
1135165385 16:20134477-20134499 GTGGAGCAGCAGATCCAGATTGG + Intergenic
1140564588 16:76026908-76026930 GAGGAGAAGCAACTGGACATTGG + Intergenic
1140915663 16:79491101-79491123 GAGGGTAAGCAGTTCGAGATAGG + Intergenic
1141924127 16:87156057-87156079 GATGAGAAGGCTATGGAGATGGG + Intronic
1143926324 17:10374451-10374473 GAGGAGGAGCAGGTAGAGATAGG + Intergenic
1144457662 17:15432310-15432332 GAGGAGAGCCCTTTCGAGATTGG - Intergenic
1144752781 17:17661355-17661377 GATGCGAAGCATTTCCAGATCGG + Intergenic
1149703934 17:58678193-58678215 GATGAAAAGCTTATCCAGATGGG + Intronic
1155554061 18:26998422-26998444 GAGTATAAACATATCCAGATTGG + Intronic
1155807094 18:30185004-30185026 GAGGAGAAGCAGCTGGACATTGG + Intergenic
1159047267 18:63381271-63381293 GAGGACCAGCATATGCAGATAGG - Intergenic
1159582181 18:70245710-70245732 GAGGAGAAGCAGCTGGACATCGG + Intergenic
1160084888 18:75767366-75767388 GAGGACAAATAAATCGAGATTGG + Intergenic
1161842945 19:6693700-6693722 GAGGAGAAGGATATTGAGGGTGG + Intronic
1165753427 19:38276204-38276226 GAGGAGAAGCATTTCAGGAGTGG + Intronic
1167423836 19:49419291-49419313 AAGGAGAAGGATCACGAGATTGG + Intergenic
1167501845 19:49852587-49852609 CAGGAGCAGCACATCAAGATGGG - Intronic
1167767392 19:51492566-51492588 TAGGTTAAGGATATCGAGATGGG + Intronic
926542994 2:14204447-14204469 GAGGAGAAGCAGCTGGACATCGG + Intergenic
927885012 2:26712977-26712999 GAGGAGCAGAAGATGGAGATGGG + Intronic
928044466 2:27914992-27915014 AAAGAGAAGAATATCAAGATGGG - Intronic
928860062 2:35846569-35846591 GAGGAGAAGCAGCTGGACATCGG - Intergenic
929495795 2:42441813-42441835 GAGGAGAAGCATATACCTATAGG - Intergenic
930044792 2:47160036-47160058 GTGGGGAAGCATATGGAGATGGG - Intronic
931265163 2:60653979-60654001 GAGGAGAAGAAGATGGAGAAAGG + Intergenic
934164143 2:89279036-89279058 GATGAGAAGATTATCTAGATGGG - Intergenic
934203131 2:89903488-89903510 GATGAGAAGATTATCTAGATGGG + Intergenic
937891213 2:126940427-126940449 GAGGAGAAGCAGCTGGACATAGG - Intergenic
940436730 2:153665166-153665188 GAGGAGAAGAATGTCTAGAATGG + Intergenic
940862767 2:158787555-158787577 GAGGAGAAGCAGCTGGACATTGG - Intergenic
941094023 2:161214916-161214938 AAGGAGAGGCATATTGAGCTTGG + Intronic
941140790 2:161778843-161778865 GAGTAAAAGAATATCAAGATGGG - Intronic
944134259 2:196381016-196381038 GAGGAGAAGCACTTCGGGAATGG - Intronic
944748390 2:202681972-202681994 GAGGAGAAGCAGCTGGACATTGG + Intronic
946563628 2:220940225-220940247 GAGGAGAAGCATCTGGATGTTGG + Intergenic
1183834681 22:40442600-40442622 GAGGATAAGAATATACAGATGGG + Intronic
950978905 3:17280519-17280541 GAGGAGAAGCAGCTAGACATTGG + Intronic
951543494 3:23805643-23805665 GAGGGGAAGCCGATGGAGATGGG - Intergenic
952242463 3:31546587-31546609 GAGGAGATGCATATACAGGTAGG + Intronic
955221490 3:57026851-57026873 GAGGAGACGAATATAGTGATAGG - Intronic
958074875 3:88664017-88664039 GAGGAGTAGCATATCAATATAGG - Intergenic
958763532 3:98337333-98337355 GAGGAGAAACAAATGTAGATTGG + Intergenic
959152572 3:102624658-102624680 GAGGAGAAACATATAGGCATTGG + Intergenic
960300103 3:115992333-115992355 GAGGAGGAGAGTAGCGAGATGGG - Intronic
961248719 3:125480953-125480975 GAGAAGAAGTTTATAGAGATAGG - Intronic
962842835 3:139251426-139251448 GAGGAGAAGGAAATGGAGTTGGG - Intronic
963930720 3:151001674-151001696 GAGGGAGAGCATATGGAGATGGG - Intergenic
964175831 3:153825553-153825575 TAGAAGAATCATGTCGAGATAGG + Intergenic
964452480 3:156825653-156825675 GCAGAGCAGCATACCGAGATAGG - Intronic
965300840 3:167002642-167002664 GAGGAGAAGCAGCTGGACATGGG - Intergenic
971820949 4:31554587-31554609 GAGGAGTTGCATAGTGAGATTGG - Intergenic
972113246 4:35592763-35592785 GAGGAGAAGCACATTGTGACTGG + Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973310070 4:48699860-48699882 GAGTAGTAGCAAATCTAGATTGG - Intronic
979443873 4:120787334-120787356 GAGGAGAAGCAAATCGTGTACGG + Intronic
980039302 4:127920854-127920876 GAGGACAAGCAGATTGATATTGG + Intronic
982004707 4:151052402-151052424 GAAGAGAAGCATTTTGAGATAGG - Intergenic
983018088 4:162639926-162639948 GAGGAGAAGCAGCTGGACATCGG + Intergenic
984300334 4:177909279-177909301 GAAGTAAAGCATATTGAGATAGG - Intronic
991155005 5:63423689-63423711 GAGGGGAAGCATAACTAGCTGGG + Intergenic
995118340 5:108507293-108507315 AAGGAGAAGAATCTTGAGATGGG - Intergenic
998186476 5:139983418-139983440 GAAGAGGAGCAGATCCAGATGGG - Intronic
999061026 5:148635380-148635402 GAGGAGAAACATATGTTGATGGG + Intronic
1000453786 5:161423283-161423305 GAGAAGAAAGATTTCGAGATAGG + Intronic
1001108954 5:168879500-168879522 GAGGAGAAGCATCTGGACAGAGG - Intronic
1007212762 6:40208921-40208943 AAGGAGAAGCAGATTTAGATGGG - Intergenic
1008639299 6:53445032-53445054 GAGAAGAAGCAAAGAGAGATGGG - Intergenic
1011023604 6:82841647-82841669 GAGAAGAAGCAGAGCAAGATCGG + Intergenic
1011672106 6:89693188-89693210 GAAGAGCAGCAAATCTAGATTGG + Intronic
1011899547 6:92275234-92275256 GAGGAGAAGCAGCTGGATATTGG - Intergenic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1015717643 6:136208714-136208736 GAAGAGAAGGCTATAGAGATTGG - Intergenic
1017998930 6:159561069-159561091 GAGGAGAAGCAGTTGGACATTGG - Intergenic
1018224473 6:161615171-161615193 GATGATAAGCATATAGAGAGGGG + Intronic
1020097191 7:5375803-5375825 GAGCAGAGGCAGATGGAGATTGG - Intronic
1020814917 7:12893506-12893528 GAGGAGTAGCAGATGGTGATGGG - Intergenic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1023039545 7:36160357-36160379 GAAGAGAAGCCTATTTAGATGGG + Intronic
1025849330 7:65233090-65233112 GAGGAGAAGCAGCTGGACATTGG + Intergenic
1028367926 7:90056046-90056068 GAGAATAAGCATCTGGAGATTGG + Intergenic
1031964534 7:128018178-128018200 GAGGAGAAACAAATTGATATAGG + Intronic
1037427409 8:18771100-18771122 GAGGAGAAGCAGCTGGACATTGG - Intronic
1042819735 8:72916883-72916905 GAGGAGAAGCAGCTGGACATTGG - Intronic
1044286839 8:90419911-90419933 GAGGAGAAGCAGCTGGACATTGG - Intergenic
1044831576 8:96255167-96255189 GAGGAGAAGACTATCAAGATAGG + Intronic
1046673583 8:117084212-117084234 GAGGAGAAGAATAAAGAAATTGG + Intronic
1050330407 9:4540121-4540143 GAGGAGAAGCAGCTAGACATTGG + Intronic
1052540453 9:29804801-29804823 GAGGAGAAGCAGATGGATGTGGG - Intergenic
1053571154 9:39309153-39309175 GAGCAGAAGCAAATCTATATTGG + Intergenic
1053837043 9:42149758-42149780 GAGCAGAAGCAAATCTATATTGG + Intergenic
1054092720 9:60867856-60867878 GAGCAGAAGCAAATCTATATTGG + Intergenic
1054114191 9:61143761-61143783 GAGCAGAAGCAAATCTATATTGG + Intergenic
1054125991 9:61309859-61309881 GAGCAGAAGCAAATCTATATTGG - Intergenic
1056427107 9:86488402-86488424 GAGGAGAAGCAGCTGGACATCGG + Intergenic
1057522366 9:95770220-95770242 GAGGACAAGGAAAACGAGATGGG - Intergenic
1057637941 9:96788172-96788194 CAGGAGAAGACTATTGAGATAGG - Intergenic
1060733750 9:126053414-126053436 AAGGAGAAGGAAATTGAGATGGG - Intergenic
1061783235 9:133008001-133008023 GAGGAGAAGGAAAGGGAGATGGG - Intergenic
1061783243 9:133008027-133008049 GAGGAGAAGGAAAGGGAGATAGG - Intergenic
1186076100 X:5881002-5881024 GCAGATAAGCATATAGAGATTGG + Intronic
1186506693 X:10099269-10099291 GAGGAGAAGAATATTGAAAACGG - Intronic
1188436274 X:30162446-30162468 GAGGAAAACCTTATCGAAATTGG + Intergenic
1190290235 X:48987719-48987741 GACCAGAAGCAGATGGAGATGGG + Intronic
1190624586 X:52324673-52324695 GAGGAGAAGCCTATCCAGTAAGG - Intergenic
1193837601 X:86364584-86364606 GAGGAGAAGCATGATGTGATGGG + Intronic
1195721309 X:107871808-107871830 GAGGAGAAGCAGCTGGACATTGG - Intronic
1198465644 X:136902474-136902496 TGGGAGAAGCATATTTAGATTGG + Intergenic
1199866209 X:151852383-151852405 GAGGAGAAGAATAGCAAGCTAGG + Intergenic