ID: 916486034

View in Genome Browser
Species Human (GRCh38)
Location 1:165259479-165259501
Sequence TATGAGAACCAAAATGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916486034_916486036 -4 Left 916486034 1:165259479-165259501 CCCACATCATTTTGGTTCTCATA 0: 1
1: 0
2: 2
3: 14
4: 219
Right 916486036 1:165259498-165259520 CATATGACTGCTTCTTACAGAGG 0: 1
1: 0
2: 0
3: 12
4: 129
916486034_916486037 14 Left 916486034 1:165259479-165259501 CCCACATCATTTTGGTTCTCATA 0: 1
1: 0
2: 2
3: 14
4: 219
Right 916486037 1:165259516-165259538 AGAGGCTGCTGACTATTGTGTGG 0: 1
1: 0
2: 1
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916486034 Original CRISPR TATGAGAACCAAAATGATGT GGG (reversed) Intronic
902958284 1:19942132-19942154 TTTGAGAACCAGATTGATGAGGG + Intergenic
904481879 1:30799080-30799102 ACTGAGAACAAGAATGATGTTGG - Intergenic
905397023 1:37673378-37673400 TCTGAGAAGCAAAAGGATTTGGG - Intergenic
905917878 1:41698532-41698554 GATGAGAACCAAGTTGATGAGGG + Intronic
907648216 1:56265455-56265477 TGTGAAAACTAAAATGATGAGGG + Intergenic
911263531 1:95716143-95716165 TATTATAACCACAATGATGCTGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
915798736 1:158765933-158765955 GATGAGAACCACAGTGAAGTGGG + Exonic
915867703 1:159522041-159522063 TGTGAAAAAAAAAATGATGTTGG + Intergenic
916486034 1:165259479-165259501 TATGAGAACCAAAATGATGTGGG - Intronic
916548729 1:165829549-165829571 TTTTAGAAACAAAATGATCTTGG + Intronic
916890719 1:169109753-169109775 TAAGAGCACCAAGATGAGGTGGG + Intronic
918727606 1:187945960-187945982 GATAAGAAGGAAAATGATGTAGG + Intergenic
920078272 1:203352867-203352889 TTTGAGAACCATTATAATGTGGG + Intergenic
921742987 1:218707675-218707697 ACTGAGAACCACATTGATGTAGG - Intergenic
923332812 1:232941152-232941174 TATGAGAACAGAAATAATGGAGG - Intergenic
923449063 1:234099150-234099172 TATCATAACCACAATGATGGAGG + Intronic
923715333 1:236420599-236420621 CAAGAGAACCAAAATGGTTTAGG + Intronic
924777598 1:247120649-247120671 TATGAAAGACAAAATTATGTTGG + Intergenic
1063029500 10:2219025-2219047 TATGTGAACGATAATGAAGTCGG + Intergenic
1063760792 10:9073070-9073092 TTTGAAAACTAAAATTATGTGGG + Intergenic
1066131374 10:32397486-32397508 TATGAGAACTAAATTGGTGGGGG - Intergenic
1067169086 10:43891232-43891254 TTTGATAACCAAAATAATGTGGG + Intergenic
1068263008 10:54607983-54608005 CACAATAACCAAAATGATGTAGG - Intronic
1068796652 10:61089631-61089653 TAAGAGAACAAATATGATGGAGG - Intergenic
1068939647 10:62668465-62668487 GATGAGGGCCAAAAAGATGTGGG - Intronic
1070705581 10:78635513-78635535 TATATGAACCAAAATGTTTTTGG + Intergenic
1070978009 10:80620941-80620963 TATGAGAACAAGAATTCTGTGGG - Intronic
1071085704 10:81866710-81866732 TCTGAAAACCAAAATTATGGGGG - Intergenic
1072252210 10:93590699-93590721 TCAGAGAACCATAATGATATAGG - Intronic
1074009803 10:109466217-109466239 TATGTGTATCAAAATCATGTGGG + Intergenic
1074728053 10:116335525-116335547 TATGAAAACCCCAATGATTTTGG - Intronic
1074847195 10:117408774-117408796 TTTGAGAACCAAAAAGGTGGAGG + Intergenic
1078077073 11:8171918-8171940 TATGAGGACAGAAATGAGGTGGG + Intergenic
1079354831 11:19722050-19722072 TATGAGAACATAAATGAAATAGG + Intronic
1080257238 11:30304543-30304565 GATGAGAACCTAAATTATGATGG - Intergenic
1080581793 11:33650475-33650497 TATGGGGACCTACATGATGTTGG + Intronic
1082875303 11:57981833-57981855 GATGAGTATCAGAATGATGTTGG + Intergenic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083817843 11:65147056-65147078 TATGGGACCCAAAGTGAGGTAGG - Intergenic
1086802097 11:91188755-91188777 AAGGAGAGCCAAAAGGATGTGGG + Intergenic
1088213459 11:107481723-107481745 TATGTGAAACAAATTGATGTAGG - Intergenic
1090467420 11:126947040-126947062 CATGAAAACCAAGCTGATGTAGG - Intronic
1090768941 11:129902263-129902285 TATGAGAACAGACATGAGGTGGG + Exonic
1092006449 12:5074327-5074349 TTTGAGAACCTGAATGATGCTGG + Intergenic
1092052861 12:5484938-5484960 GATGAGAAACAAAATAATGTAGG - Intronic
1093002658 12:14015383-14015405 TATAAGAACAAAATAGATGTAGG + Intergenic
1096324440 12:50646879-50646901 TATCAGAAATAAAATGATCTTGG - Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1098461978 12:70742091-70742113 TATGAGAACCAAAGAGATAATGG + Intronic
1098576340 12:72047155-72047177 GGTGAGAACCACAAAGATGTAGG + Intronic
1099788764 12:87302789-87302811 TATGAGACCAAAAATAATTTTGG + Intergenic
1100893746 12:99156276-99156298 TATGAGAACAAAATCAATGTAGG - Intronic
1104067983 12:125320879-125320901 TCTGAGAACCACAATGTTTTTGG + Intronic
1104523687 12:129498584-129498606 TCTGAGAAGGAAAAAGATGTTGG - Intronic
1105238685 13:18588853-18588875 TTTGAGTATCAAAATAATGTTGG + Intergenic
1105793836 13:23831332-23831354 TCTGAGTACCCAAATGATCTGGG + Intronic
1107296181 13:38910641-38910663 GACAAGAACCAAACTGATGTAGG + Intergenic
1107740681 13:43446733-43446755 CATGAGAACCAAGCTGATTTGGG - Intronic
1108893241 13:55290076-55290098 TATGAGCACCAATTTTATGTTGG + Intergenic
1109575372 13:64249873-64249895 TATGAGAACCTAACTGACCTAGG + Intergenic
1110177092 13:72569778-72569800 TATGTGAACAAAAATCTTGTTGG - Intergenic
1110506213 13:76290159-76290181 TTTGAGAACAAAAGTTATGTTGG - Intergenic
1111595421 13:90404399-90404421 GAGGAGACCCAAAATGATTTTGG - Intergenic
1112192768 13:97193884-97193906 AAAGTGACCCAAAATGATGTGGG - Intergenic
1113131908 13:107046314-107046336 TATGAGAAATAAATTTATGTTGG - Intergenic
1114970763 14:28025674-28025696 CATTAGAACCAAAATGAAGAAGG + Intergenic
1116096254 14:40373100-40373122 TATGGGAACCACAAGGATGTTGG + Intergenic
1116572837 14:46539591-46539613 ATTTAGAACCAAAATGTTGTAGG - Intergenic
1117099527 14:52332397-52332419 TATGATAACCAAAACACTGTGGG + Intergenic
1118566538 14:67147114-67147136 TAGCAGAACAAGAATGATGTAGG - Intronic
1120392580 14:83927556-83927578 TCTGTGAAAAAAAATGATGTTGG - Intergenic
1120472101 14:84938633-84938655 CATGAGAAGGGAAATGATGTGGG - Intergenic
1123892946 15:24799640-24799662 AACTAAAACCAAAATGATGTTGG - Intergenic
1123959863 15:25386056-25386078 TAGCAAAGCCAAAATGATGTGGG + Intronic
1124199912 15:27670362-27670384 TTTGAGCAACAAAATGGTGTTGG + Intergenic
1125458366 15:39884600-39884622 TATGAGAACACAAACCATGTGGG - Intronic
1126737073 15:51741143-51741165 TATGAGAACTAAAGCAATGTGGG + Intronic
1127360692 15:58242476-58242498 AATGAGAAAAAAAATGATGATGG + Intronic
1129978299 15:79842341-79842363 TATGAGAACTAAAGCAATGTGGG + Intronic
1131767162 15:95690683-95690705 CCTGAGGACTAAAATGATGTTGG + Intergenic
1133589440 16:7228412-7228434 TAAGAGAGCCATAATGATTTAGG - Intronic
1133901228 16:9976987-9977009 AATCAGAACCAAAATTATTTTGG - Intronic
1137040436 16:35606851-35606873 TATGTGATCCAAAATTATATTGG - Intergenic
1137438220 16:48475764-48475786 AAAGAGAACAAAAATAATGTAGG - Intergenic
1137706592 16:50539794-50539816 CAGAAGAAACAAAATGATGTGGG + Intergenic
1139242563 16:65408919-65408941 CATGAAAACAAAAATGATGGAGG - Intergenic
1142659979 17:1421939-1421961 TATGAGACCAAAAATGACCTAGG - Exonic
1143178727 17:4971266-4971288 TAGGAGAACCAAGATGACGGAGG - Intronic
1150420412 17:65029022-65029044 AATGAGAAACATAAGGATGTTGG + Intronic
1150426352 17:65080006-65080028 TATAAGAAAAAAAATGAGGTCGG - Intergenic
1150456528 17:65310900-65310922 TAGGAGAAGCAAAATCCTGTTGG + Intergenic
1153104048 18:1507507-1507529 TCTGAAAACCAAAATAATTTTGG + Intergenic
1154953944 18:21237544-21237566 TCTGAAAACCAGAATGATGTTGG - Intergenic
1155849029 18:30747435-30747457 TATGAGAACAGAAATGGTTTAGG + Intergenic
1156424035 18:36989225-36989247 TTTGAGAATAAAAATGAGGTTGG + Intronic
1158234469 18:55298090-55298112 TCTGCAAACCAAATTGATGTTGG + Intronic
1158678529 18:59545397-59545419 CATGAAAACAAAAATGTTGTGGG - Intronic
1159532041 18:69667011-69667033 TATGAGAACTAAAGGGAGGTTGG - Intronic
1160462978 18:79053382-79053404 TCAGAGAACCAAAATGCTTTCGG + Intergenic
1167826901 19:51981577-51981599 TGTCTGAACCAAAATGATATGGG + Intronic
1168493870 19:56834386-56834408 AATCAGAACCAAGAGGATGTGGG - Intronic
926218093 2:10917651-10917673 TATGAGAATCAGAATGGGGTGGG - Intergenic
926938519 2:18111570-18111592 TTTGAAAACCAAAATGGTGAAGG + Intronic
927020645 2:19013396-19013418 TATGAGAAATAAAATGAACTCGG + Intergenic
927058926 2:19395436-19395458 GATGAGAACCTAAGTGATTTTGG - Intergenic
928299320 2:30111592-30111614 TTTCAGAAACAAAATGATGAAGG - Intergenic
928452896 2:31394157-31394179 AAAGAGAAGGAAAATGATGTAGG - Intronic
928752244 2:34484519-34484541 TATGACACCCAAAATGTTTTTGG + Intergenic
929065498 2:37969520-37969542 TATAAGAACAAAATTGATTTTGG + Intronic
930194159 2:48492618-48492640 TATGAGAAGTAGAATGTTGTAGG + Intronic
932536227 2:72599521-72599543 TAGGACATCCAATATGATGTTGG - Intronic
933641199 2:84762106-84762128 TGAAAGAACCAAATTGATGTAGG + Intronic
934682472 2:96294772-96294794 TATAAAACCCTAAATGATGTTGG + Intronic
934909933 2:98242537-98242559 TATGATAACGACAATGATGATGG - Intronic
939195164 2:138962749-138962771 GATGACAGCCAAAATGATGACGG - Intergenic
939223252 2:139331133-139331155 AATGAGAATGAAAATGATATAGG + Intergenic
939403040 2:141719560-141719582 TAGGAGACTCAAAATGATTTTGG + Intronic
940545693 2:155081229-155081251 CATTAGAACAAAAATAATGTTGG - Intergenic
941470388 2:165878498-165878520 TAAGATATACAAAATGATGTCGG + Intronic
942702636 2:178730960-178730982 TTCGAGGTCCAAAATGATGTTGG - Exonic
945135257 2:206620127-206620149 TAACAGAAACAAAATCATGTTGG + Exonic
947490545 2:230591041-230591063 GATGAGAACCAAGATTATCTAGG + Intergenic
1170358039 20:15513626-15513648 TATGAAAAACAGTATGATGTAGG - Intronic
1171271786 20:23823825-23823847 TATGAGAAGCAAAAGGAAGGAGG + Exonic
1172607427 20:36223429-36223451 TAAGAGAAATAAGATGATGTTGG + Intronic
1175538210 20:59730036-59730058 TATGAGAACCAAAAGGAGATGGG - Intronic
1176169690 20:63691186-63691208 CCAGAGAACCAAAGTGATGTGGG - Intronic
1177297944 21:19201565-19201587 TAGGGGAACCAAAAGGATTTGGG + Intergenic
949224324 3:1675286-1675308 TATGAAAACTAAAATGAAATAGG - Intergenic
949614980 3:5743659-5743681 TGTTAGAACCAAAATCATCTAGG - Intergenic
949817959 3:8081240-8081262 AATCAGAATCAAAATGATATTGG - Intergenic
950860303 3:16141863-16141885 TATGAAAACTAAATTTATGTTGG + Intergenic
952093219 3:29916656-29916678 AAGGAGAACCAAAAATATGTGGG + Intronic
952268837 3:31812900-31812922 AATGTGTACTAAAATGATGTAGG + Intronic
953048616 3:39318860-39318882 TATAGGAACCAAATTGATGTTGG + Intergenic
954607910 3:51928428-51928450 TATGAGAAGCAAAGAGATGAAGG + Intergenic
956927758 3:74007823-74007845 TAGGAAAACCAGAATGAAGTGGG + Intergenic
962036027 3:131652769-131652791 TCTGAGAATCAAACTTATGTAGG + Intronic
962698556 3:137974690-137974712 TTAGAGAAACAAAATCATGTAGG - Intergenic
963773803 3:149418328-149418350 TGTGAGAAAAAAAATGATATTGG + Intergenic
963998955 3:151744680-151744702 GATGTGTACCAAAAAGATGTTGG - Intronic
965225012 3:165977190-165977212 TATGTCAACCAAATTGATCTTGG + Intergenic
965356183 3:167675984-167676006 TATGATCACAAAAATGAGGTAGG + Intergenic
965442012 3:168726138-168726160 GGTGAGAACCAATATGATGAAGG - Intergenic
967290814 3:187918382-187918404 AATGAGAGGCAAAGTGATGTTGG - Intergenic
967394239 3:188989533-188989555 TGTCAGAAACAAAATGTTGTTGG + Intronic
968036422 3:195551870-195551892 TTTGAGAACCAAAATGGTGTGGG + Intergenic
970835452 4:20400057-20400079 TAACAAAACCAAAATGATTTAGG - Intronic
971548554 4:27918770-27918792 TATGAGAACTAAAATGCAGAGGG + Intergenic
971779017 4:31006523-31006545 GATGAGATCCAAATGGATGTAGG + Intronic
975319266 4:72992023-72992045 CATGAAAACCAAAATGATCTTGG - Intergenic
975579823 4:75896283-75896305 TCTGGAAAGCAAAATGATGTTGG + Exonic
975863038 4:78698191-78698213 TATGAAAACCACACTGATGTGGG - Intergenic
976187471 4:82457003-82457025 TGTCAGAAACAAAATGTTGTTGG - Exonic
976474284 4:85465158-85465180 TCTGAGAACCAAAACATTGTAGG - Intergenic
977572558 4:98644784-98644806 TATGAGAAGGAAAATGCTTTGGG - Intronic
978267362 4:106842400-106842422 TATGAGAACCAAATTTAGGAGGG - Intergenic
978944638 4:114480948-114480970 TTTCAGAACCAAAAAGATCTGGG + Intergenic
979673754 4:123388330-123388352 TGTATGAACCAAAATGATCTTGG + Intergenic
980418222 4:132521260-132521282 AATGAGAAGCTAAATGCTGTGGG - Intergenic
982395750 4:154913845-154913867 AATGAGTACCAACATGATGGCGG + Intergenic
983335193 4:166383017-166383039 TTTTAGAACAAGAATGATGTTGG + Intergenic
983784220 4:171712109-171712131 TATGAGAATGAAATTGAGGTAGG + Intergenic
984133439 4:175906791-175906813 GATGAGAACCCAAATTAAGTTGG + Intronic
985042795 4:185908752-185908774 TAGGAGACCCACAATGATGGAGG + Intronic
985935622 5:3095524-3095546 TATGAGAAACAAAATGTTTATGG - Intergenic
986940940 5:12948446-12948468 TATCAGAACCTAATTGATCTGGG + Intergenic
986982453 5:13464819-13464841 TAGGAGAAACAGATTGATGTAGG + Intergenic
990479636 5:56197057-56197079 TATTTGCACCAAAATCATGTAGG - Intronic
991641175 5:68754792-68754814 TAAGACAACCACAATGAGGTTGG + Intergenic
992764694 5:79986784-79986806 CATGAGAATAAAAATGAAGTCGG + Intronic
992917967 5:81478997-81479019 TTTGAAAACCAATTTGATGTTGG - Intronic
993750496 5:91660497-91660519 TATTTAAACCAAAAGGATGTTGG + Intergenic
993939718 5:94044179-94044201 TGTTAGAACCAAGCTGATGTGGG - Intronic
994083840 5:95737169-95737191 TTTGAAAACCAAAATGACTTTGG + Intronic
997801545 5:136867621-136867643 TATGAGGACCAAATAGATGTAGG + Intergenic
999786896 5:154898828-154898850 TATGAGAAACAATATCATATAGG + Intronic
1002992400 6:2249959-2249981 TATGAGATGCAAAATGGTCTGGG - Intergenic
1004357773 6:14945039-14945061 TATGAGAACCATAGTGTTGGGGG - Intergenic
1005431569 6:25763452-25763474 GATGAGAATAAAACTGATGTTGG - Intronic
1011074362 6:83422281-83422303 TTTGAAAACCAAATTGATATCGG + Intronic
1011321743 6:86102641-86102663 AATGAAAACCAAAATCAAGTGGG - Intergenic
1012365427 6:98433434-98433456 AATGTAAACAAAAATGATGTGGG - Intergenic
1013765987 6:113574844-113574866 TAATTGTACCAAAATGATGTAGG + Intergenic
1016043021 6:139451992-139452014 TATGAAAACCAAAAATCTGTAGG - Intergenic
1016413592 6:143809617-143809639 TGTGAGAACAGAAATGAGGTTGG - Intronic
1017478711 6:154827735-154827757 CTTGAGAAGCAAAATGCTGTAGG + Intronic
1020476700 7:8603531-8603553 CATGATACCCAAAATGATGAAGG - Intronic
1020575016 7:9915073-9915095 TATGAGAAATAAATTGCTGTTGG + Intergenic
1021037040 7:15812187-15812209 AATGAGGATCAAATTGATGTTGG - Intergenic
1022561129 7:31350887-31350909 TGTGAGGACAAAAATGATCTCGG + Intergenic
1027339883 7:77195476-77195498 TCTGGGAACCAAAATGCTGTAGG + Exonic
1027435754 7:78162863-78162885 GATGAGTAGAAAAATGATGTGGG - Intronic
1027525503 7:79264262-79264284 TTTGAGAAACAAAATGCTTTTGG + Intronic
1029343370 7:99961896-99961918 TATTAGAAACAACATGATGGGGG - Intergenic
1032723271 7:134568236-134568258 TATGAGAATCAACATGAGGTGGG + Exonic
1034232940 7:149546903-149546925 TCTGAGAACCAGAATGACCTGGG + Intergenic
1035197915 7:157238533-157238555 TATGAGAACTAGAAGGATGGAGG + Intronic
1036205294 8:6801100-6801122 TATGAGAGTCAACAGGATGTCGG + Intergenic
1037102825 8:15068226-15068248 GATGAGTATCACAATGATGTTGG - Intronic
1037649809 8:20826051-20826073 TAGGATAACCAGAATGTTGTGGG - Intergenic
1039005296 8:33029945-33029967 AATGAAAACCAAAAACATGTAGG + Intergenic
1039190147 8:34964350-34964372 TATGATAATTAAAATCATGTAGG + Intergenic
1040040894 8:42915946-42915968 CATGAGATCCTAAGTGATGTGGG + Intronic
1041602356 8:59734810-59734832 TATGAAAAACAAACTGATGAGGG + Intergenic
1042411322 8:68469608-68469630 TAAGGGAACCAAAAAAATGTAGG - Intronic
1043137486 8:76546720-76546742 GATGAGAACCAAAAGGCTATTGG - Intergenic
1044415910 8:91939320-91939342 TATGGAAACCAAAATCATGGGGG + Intergenic
1045827218 8:106412535-106412557 TTTCAGAACCAAATTTATGTTGG + Intronic
1046250037 8:111618378-111618400 TGTGAGAAAAAAAATGATGCTGG - Intergenic
1047554413 8:125913682-125913704 GTGGAGAACCAAAATGATATGGG + Intergenic
1047787070 8:128163724-128163746 TATGAGAAACAGTAAGATGTTGG - Intergenic
1048727047 8:137398413-137398435 TATCAGAACCAAACTGATGTGGG - Intergenic
1050031395 9:1389909-1389931 TATGGGGTACAAAATGATGTTGG + Intergenic
1052053856 9:23882001-23882023 TGTGAGGACAAAAATGATTTGGG - Intergenic
1054736587 9:68758042-68758064 TTTGAAAACTAAACTGATGTTGG + Intronic
1056235654 9:84591324-84591346 TATAAGAACCACTAGGATGTGGG + Intergenic
1056387710 9:86112710-86112732 TATGAGAACAAAAAAAATGGGGG + Intergenic
1059431331 9:114252259-114252281 AATAAGGACCAACATGATGTGGG + Intronic
1059817363 9:117932329-117932351 TATGAAAAACAAAAAGATTTGGG - Intergenic
1186575004 X:10755849-10755871 TATGAGAACAAAATTGAGGTGGG + Intronic
1187185667 X:16982818-16982840 TATCAGAATGAAAATGATGTGGG + Intronic
1188331266 X:28874322-28874344 TATGTGAATAAAAATGATGGTGG - Intronic
1188626267 X:32289003-32289025 TGTTGGAACCAAAGTGATGTGGG - Intronic
1188675858 X:32938164-32938186 CAAGAGAACCAGAATGATTTTGG - Intronic
1191656469 X:63604186-63604208 TAAGAAAACCAGAAAGATGTGGG + Intergenic
1194430273 X:93794971-93794993 TATAAGTAACAAAGTGATGTTGG + Intergenic
1194801018 X:98272876-98272898 TATGAGAAACAAAATGGCATAGG + Intergenic
1195134976 X:101896623-101896645 TATGAGTTCAAAATTGATGTTGG + Intronic
1197371563 X:125632922-125632944 TCTGTGAAAAAAAATGATGTTGG - Intergenic
1197515758 X:127426335-127426357 TATCAGAAAGAAAATGATGGTGG + Intergenic
1197802840 X:130370110-130370132 TCTGAGACCAAAACTGATGTTGG - Intronic
1198433338 X:136589852-136589874 TATGATGACTAAAATGTTGTGGG + Intergenic
1200979210 Y:9246489-9246511 TATGAGATCCAAAATTCTGGAGG - Intergenic
1202132156 Y:21622653-21622675 TATGAGATCCAAAATTCTGGAGG + Intergenic