ID: 916488592

View in Genome Browser
Species Human (GRCh38)
Location 1:165281025-165281047
Sequence CAGAACATGGAGAAGTAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916488592 Original CRISPR CAGAACATGGAGAAGTAGTC TGG Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901240408 1:7689760-7689782 GAGAGCATGCAGAAGGAGTCAGG - Intronic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
903763373 1:25715343-25715365 CAGAACATGGACTAGGAGTTGGG + Intronic
904130426 1:28271776-28271798 CAGAAGCTGGTAAAGTAGTCAGG - Exonic
905035985 1:34918636-34918658 GAGAAAATGGAGAAGTAGGTCGG + Intronic
909679709 1:78278213-78278235 GAGAAGATGGAGAGGTAGACAGG + Intergenic
913322408 1:117598217-117598239 AGGAACATGGAGAAGTCATCTGG - Intergenic
915125032 1:153657972-153657994 CAGAAAATGAAAAATTAGTCAGG + Intergenic
916323864 1:163535238-163535260 CAGAAGCTGGAGAGGTAGTTGGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916837589 1:168563918-168563940 CAGAACAATGAGAAATAGGCGGG + Intergenic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919631850 1:199966972-199966994 AAGAAAATGGAGAAGAAGCCAGG + Intergenic
921042715 1:211448925-211448947 CAGAACAAAGAGAAATACTCTGG + Intergenic
923187769 1:231590577-231590599 CATAACACGGAGTAGTAGTATGG - Intronic
924658162 1:245992416-245992438 AAGAACATGGTGTGGTAGTCAGG - Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
924818160 1:247460959-247460981 TAGAACATTGAGAAGGAGCCAGG + Intergenic
1064300610 10:14119527-14119549 CAGATCAGGGAGCAGTAGTGAGG + Intronic
1064647914 10:17479013-17479035 CAGAGCGTGGAAAAGTGGTCAGG - Intergenic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1068721672 10:60252784-60252806 AAGTACATCCAGAAGTAGTCAGG - Intronic
1069757466 10:70782001-70782023 CTGAAACTGGAGAAGAAGTCAGG - Exonic
1074280260 10:112044850-112044872 GACAACATGGGGAAGAAGTCCGG - Intergenic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1076591579 10:131587248-131587270 CAGACCATGGGGATGTGGTCAGG + Intergenic
1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG + Exonic
1077626314 11:3774921-3774943 CAGAAAATGAAGAATTTGTCAGG - Intronic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1083653630 11:64218828-64218850 TGGAACATGGGGAAGCAGTCAGG - Intronic
1083896820 11:65624225-65624247 CAGCAGATGCAGAAGTAGACAGG - Exonic
1085960064 11:81451173-81451195 CTGAACATGGAGAGGTAGCTGGG + Intergenic
1090651653 11:128811725-128811747 CAGAACTTGGAAAAGTTGTAGGG + Exonic
1091147057 11:133289253-133289275 CAAAACATGAAGGAGAAGTCAGG - Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1093003617 12:14027689-14027711 AAGAAGATGTAGAAGTAGTGGGG + Intergenic
1098801070 12:74958908-74958930 TATAACATGGAGAAGTGGTTTGG - Intergenic
1099624571 12:85053580-85053602 CAGAAAATGGAGGAAGAGTCAGG - Intronic
1101992995 12:109502652-109502674 CAGAAAATAGAGATGTAGCCAGG + Intronic
1102209624 12:111116328-111116350 CAGAATATTGAGAAGTGGTGAGG + Intronic
1102962558 12:117102052-117102074 CAGGGCTTGGAGAAGTAATCAGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1107104103 13:36625303-36625325 AAGCACATGTAGAAGTAGACAGG + Intergenic
1114055136 14:18961815-18961837 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
1114107406 14:19439963-19439985 TAGAAAATGCAGAAGTAGCCTGG + Intergenic
1114183502 14:20383645-20383667 CTGTACATGGAGAGGAAGTCAGG + Intronic
1114780761 14:25536083-25536105 CAGAACATGGAAAACTATTAAGG + Intergenic
1116672412 14:47860509-47860531 CAGGACAAGGAGTAGTGGTCAGG + Intergenic
1116867438 14:50042274-50042296 CAGAGCATGGAGAATTACACAGG - Intergenic
1119735241 14:76977446-76977468 CAGACCCTGGAGGAGTGGTCTGG - Intergenic
1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG + Intergenic
1121887757 14:97560402-97560424 CAGGACATGGAGATGAAGCCTGG + Intergenic
1121999948 14:98639068-98639090 CAGCACATGGATGAGTAGGCAGG + Intergenic
1126265814 15:46752733-46752755 CAAGGCATGTAGAAGTAGTCAGG + Intergenic
1129143966 15:73631897-73631919 GAGAAGATGGAGAAGTGGTGGGG - Intronic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131940485 15:97559601-97559623 CAGAAGATGTAGAAGTGGTATGG - Intergenic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1140787765 16:78360287-78360309 TAGAAGTTGGAGAAGTAGGCTGG + Intronic
1141305796 16:82862787-82862809 CAGATCATGCAGATGCAGTCGGG + Intronic
1142886102 17:2912879-2912901 AAGAACATGGAGATGTTGGCTGG + Intronic
1148546559 17:48523725-48523747 TAGAAGATGGATAAGAAGTCTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1151784122 17:76266638-76266660 CAGCACACAGAGAAGTGGTCCGG + Intronic
1152153273 17:78616218-78616240 CTGGACGTGGAGAAGTCGTCTGG - Intergenic
1157104631 18:44762172-44762194 CAGAACTGGGAAAAGAAGTCAGG - Intronic
1161027572 19:2043563-2043585 CAGATCATTGAGAAGCAGCCAGG - Exonic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1164630829 19:29760465-29760487 CAGAAAGTGGAGACCTAGTCAGG - Intergenic
1165144227 19:33721288-33721310 CAGAAGATGGAGAAGGACTGGGG - Intronic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1168250008 19:55136628-55136650 GAGAACATGGAGAAACAGGCGGG + Intronic
925130756 2:1492606-1492628 CAGAACTGGGAGAAATAGCCAGG - Intronic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
936275600 2:111094167-111094189 GAAAACCTGGAGAAGTCGTCAGG + Intronic
937536632 2:122896801-122896823 AACAAGATGGAGTAGTAGTCAGG + Intergenic
937617230 2:123940454-123940476 CAGATCATGGAGAAGAAATGAGG - Intergenic
938473146 2:131584604-131584626 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
939105714 2:137946213-137946235 CAGAACATGGACAGGTGGTTGGG + Intergenic
941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG + Intergenic
943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG + Intergenic
945520712 2:210823964-210823986 CAGAACACTGAGAAAGAGTCTGG + Intergenic
947123810 2:226845577-226845599 CAGAATATAAAGAAGTTGTCAGG - Intronic
947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG + Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1169284656 20:4297846-4297868 CTGAACAAGGAGAAAAAGTCAGG - Intergenic
1173228658 20:41177194-41177216 CAGACCAGGGACAAGTAGACTGG + Intronic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1179095478 21:38310846-38310868 CAAAACATGGAGAGGAAGCCAGG - Intergenic
1180228993 21:46414934-46414956 CAGAGCCTGGAGGAGTAGTTGGG - Intronic
1180473618 22:15684365-15684387 TAGAAAATGCAGAAGTAGCCTGG - Intergenic
950969916 3:17176039-17176061 GAGAACATGGAGAGGCAGCCTGG + Intronic
952950882 3:38524063-38524085 CAGGACCTAGAGAAGTTGTCAGG + Exonic
953200856 3:40777368-40777390 CTGCAGATGGAGTAGTAGTCAGG + Intergenic
955275190 3:57540495-57540517 AAGAACAAGGATAAGTATTCAGG + Intronic
956630286 3:71310607-71310629 CGGAACATGGAGAGGGAGGCAGG - Intronic
959738418 3:109687657-109687679 AAGAGCATGGAGAAATATTCTGG + Intergenic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
962884798 3:139614324-139614346 CAGAAAGTAGGGAAGTAGTCAGG - Intronic
963702718 3:148645969-148645991 TAGAACATGGAGAAGAAATTAGG + Intergenic
964045525 3:152320434-152320456 CAGCACATGGGGACCTAGTCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968864490 4:3199108-3199130 CAGCTCCTGGAGAAGGAGTCAGG - Intronic
970587193 4:17526026-17526048 CAAAACATAGGGAAGTAGTTTGG + Intronic
971197194 4:24480833-24480855 CAGAAGATCAAGAAGAAGTCTGG + Intergenic
974919397 4:68219668-68219690 ATGATCATGGAGAATTAGTCTGG - Intergenic
977799538 4:101210199-101210221 GGGAACTTGGAGAAATAGTCTGG - Intronic
978272689 4:106909562-106909584 AAGAACATGGGGAAGTGGTTGGG + Intergenic
978275379 4:106942938-106942960 CAAGACCTGGAGAAGTAGGCAGG - Intronic
979603349 4:122609743-122609765 CTGAACATGGAGGAGTGGCCAGG + Intergenic
981678909 4:147371859-147371881 CAGAACAGGAAGAAGCAGTTAGG - Intergenic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983508178 4:168578000-168578022 AAGAACATTGAAAAGTAGTATGG - Intronic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
988795703 5:34651537-34651559 CAGAACGGGGAGAAGTAATGAGG + Intergenic
990679603 5:58226884-58226906 CATACCATGGAAAAGTACTCAGG + Intergenic
994715398 5:103315549-103315571 CAGAAAGTAGAGAAGTAGTAAGG + Intergenic
995023214 5:107389880-107389902 CAGAAAATGAGGAAGTAGTGGGG - Intronic
996013730 5:118508074-118508096 CAGGACATGCTGAAGTAGGCAGG + Intergenic
996951820 5:129135921-129135943 CAAGACATGGAGAAGTAGAAAGG - Intergenic
1000356078 5:160397191-160397213 CACAACCTGGTTAAGTAGTCAGG + Intronic
1000496610 5:161991953-161991975 CTGAATAGGGAGAAATAGTCAGG - Intergenic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1007159550 6:39777959-39777981 GAGAACATGGAGAAGGTCTCAGG - Intergenic
1007235360 6:40387373-40387395 CAGAAGATACAGAAGTACTCAGG + Intergenic
1007513388 6:42391765-42391787 CAGAACATGGAGCAGTGGGCTGG + Intronic
1007784598 6:44272399-44272421 CAGAACATGGGGAATGAGACTGG + Intronic
1010050799 6:71501959-71501981 CAAAAAATGGAGAGTTAGTCAGG - Intergenic
1010345586 6:74806420-74806442 GAGATGATGTAGAAGTAGTCAGG - Intergenic
1010370679 6:75103476-75103498 CAGAACATGGGGAAGCAGAGGGG - Intronic
1012629135 6:101441892-101441914 CAGAACATAAGAAAGTAGTCTGG + Intronic
1013796557 6:113895421-113895443 CAGATCTTGGAGAAGTTGTGGGG + Intergenic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017249387 6:152263047-152263069 CAGGACATGGAGAGATAGTACGG + Intronic
1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG + Intronic
1021496392 7:21279097-21279119 CTGAATATGGAGAAACAGTCAGG - Intergenic
1023238395 7:38115333-38115355 AAGAACATGAAGAAGTATTTAGG - Intergenic
1023344043 7:39252921-39252943 CAGAAAATGGACAAATACTCAGG - Intronic
1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG + Intronic
1028070769 7:86447326-86447348 CAGAACAGAAAGAAGTAGTGAGG + Intergenic
1028342216 7:89735509-89735531 CAGACCTTGGAGACGTTGTCAGG - Intergenic
1028869768 7:95756799-95756821 CAGAAAAGGGACAGGTAGTCAGG - Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1031957472 7:127957057-127957079 CAGAACATTGAATAGTAGACTGG - Intronic
1032456075 7:132074557-132074579 CAGGACATGGAGGAGTAAACTGG + Intergenic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1035687594 8:1537017-1537039 CACACCTCGGAGAAGTAGTCAGG + Intronic
1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG + Intergenic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1038084898 8:24185195-24185217 CAGAACATGGAGAACTTTTAGGG + Intergenic
1040768952 8:50950123-50950145 CAGAACAGCCAGAAGTACTCTGG + Intergenic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044875959 8:96666578-96666600 CAGAACATGGGAAAGTATGCTGG + Intronic
1046634285 8:116655707-116655729 TATAACATGGAGTAATAGTCTGG - Intronic
1048046904 8:130781224-130781246 CAGAGCATGGACCAGAAGTCAGG + Intronic
1057848893 9:98549239-98549261 CAAAACATGGAAAAGAAGCCAGG - Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG + Intronic
1060611875 9:124973939-124973961 AAGAACATGGAGAACTAGATGGG - Intronic
1186169065 X:6858147-6858169 CAAAACATGGATAAGAACTCTGG + Intergenic
1186177372 X:6938940-6938962 CAGATAATGGATAAGTATTCTGG + Intergenic
1187543690 X:20225883-20225905 CAGAAGATGGAAAAGAAGTGGGG + Intronic
1189395963 X:40623155-40623177 CAGAACATTGGCATGTAGTCTGG + Intergenic
1189860057 X:45262817-45262839 AAGACCATGGAGAGGTATTCTGG + Intergenic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1191613506 X:63142257-63142279 TAGTACAGAGAGAAGTAGTCTGG - Intergenic
1191622791 X:63236670-63236692 TAGTACAGAGAGAAGTAGTCTGG + Intergenic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1192357832 X:70420442-70420464 GAGAACATAGAGTAGTAGTCTGG - Exonic
1193038215 X:76976579-76976601 CAGAACATGGAGAAACAAACTGG + Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198511730 X:137358823-137358845 ATGAAGATGGAGAAGTAGCCAGG - Intergenic
1198805018 X:140485459-140485481 CTAAACATGGAAAATTAGTCAGG + Intergenic