ID: 916489065

View in Genome Browser
Species Human (GRCh38)
Location 1:165285615-165285637
Sequence CAGTGGAGATGGTGAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 8, 3: 37, 4: 298}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916489065_916489075 20 Left 916489065 1:165285615-165285637 CCAGCTGTTCACCATCTCCACTG 0: 1
1: 0
2: 8
3: 37
4: 298
Right 916489075 1:165285658-165285680 GGGCTCAGCCTGATGGACTAGGG 0: 1
1: 0
2: 0
3: 6
4: 128
916489065_916489074 19 Left 916489065 1:165285615-165285637 CCAGCTGTTCACCATCTCCACTG 0: 1
1: 0
2: 8
3: 37
4: 298
Right 916489074 1:165285657-165285679 TGGGCTCAGCCTGATGGACTAGG 0: 1
1: 0
2: 0
3: 18
4: 174
916489065_916489073 13 Left 916489065 1:165285615-165285637 CCAGCTGTTCACCATCTCCACTG 0: 1
1: 0
2: 8
3: 37
4: 298
Right 916489073 1:165285651-165285673 AAGGAATGGGCTCAGCCTGATGG 0: 1
1: 1
2: 1
3: 17
4: 266
916489065_916489076 26 Left 916489065 1:165285615-165285637 CCAGCTGTTCACCATCTCCACTG 0: 1
1: 0
2: 8
3: 37
4: 298
Right 916489076 1:165285664-165285686 AGCCTGATGGACTAGGGCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 128
916489065_916489070 -1 Left 916489065 1:165285615-165285637 CCAGCTGTTCACCATCTCCACTG 0: 1
1: 0
2: 8
3: 37
4: 298
Right 916489070 1:165285637-165285659 GAGGAACAAACCAAAAGGAATGG 0: 1
1: 0
2: 1
3: 71
4: 760
916489065_916489071 0 Left 916489065 1:165285615-165285637 CCAGCTGTTCACCATCTCCACTG 0: 1
1: 0
2: 8
3: 37
4: 298
Right 916489071 1:165285638-165285660 AGGAACAAACCAAAAGGAATGGG 0: 1
1: 0
2: 0
3: 41
4: 507
916489065_916489069 -6 Left 916489065 1:165285615-165285637 CCAGCTGTTCACCATCTCCACTG 0: 1
1: 0
2: 8
3: 37
4: 298
Right 916489069 1:165285632-165285654 CCACTGAGGAACAAACCAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916489065 Original CRISPR CAGTGGAGATGGTGAACAGC TGG (reversed) Intronic
900779331 1:4607484-4607506 CAGTGGAGAGGATGAAAAGTAGG + Intergenic
904067792 1:27768040-27768062 CAGTGGAGCTGCTGAATTGCTGG + Intergenic
904265764 1:29317858-29317880 CAGTGGAGATGAGGAAGGGCAGG - Exonic
905005261 1:34704586-34704608 CAGAGGAGATAGTCAACAACTGG - Intergenic
905836018 1:41121971-41121993 CAGTAGAGATGGTGAAATGTGGG - Intronic
905972124 1:42150180-42150202 CAGTGGAGATGATGAGAAACGGG + Intergenic
906713969 1:47953208-47953230 CAGTGCAGATGATGCACAGAGGG + Intronic
907619308 1:55960072-55960094 CAGTGGAGACAGTGACCTGCTGG - Intergenic
909319895 1:74271630-74271652 CAGTGGAGCTGATATACAGCAGG + Exonic
910125396 1:83836445-83836467 CAGTGGAGATAAGGAACAGCTGG - Intergenic
910313584 1:85856679-85856701 CAGTGGAGGTGGGGAAGAGTAGG - Intronic
911059678 1:93737189-93737211 CAGTGGTGATGGTGAAAGTCTGG + Intronic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
914448552 1:147771217-147771239 CAGTGTAGACGATGAAGAGCAGG + Intronic
914880505 1:151542799-151542821 GGGAGGAGATGGTGAACAGTCGG + Intronic
915089551 1:153414928-153414950 CACTGGAGACAGTGAAGAGCAGG - Intergenic
915907896 1:159892427-159892449 CAATGAAGATGTTGAAGAGCAGG + Intronic
916470859 1:165120796-165120818 AGGTGGAGATGCTGAACAGGTGG - Intergenic
916489065 1:165285615-165285637 CAGTGGAGATGGTGAACAGCTGG - Intronic
918070530 1:181130769-181130791 CAGTGGAGGAGGGGCACAGCTGG + Intergenic
918120367 1:181532860-181532882 TACTGGAGATGGAGAACACCTGG + Intronic
918225197 1:182474756-182474778 CACAGCAGAAGGTGAACAGCGGG + Intronic
919983308 1:202656038-202656060 GAGAGGAGTGGGTGAACAGCGGG + Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
1064998121 10:21314219-21314241 TGCTGGAGATGGTGAACAGCTGG - Intergenic
1068434354 10:56971488-56971510 CAAAGGAGATGGAGAACAGCTGG - Intergenic
1068714866 10:60177005-60177027 CAGTGGAGATGGTGAAATGTAGG - Intronic
1069008225 10:63341958-63341980 CAGTGATGATGGTGAACAAATGG + Intronic
1069008227 10:63341998-63342020 CAGTGATGATGGTGAACAAATGG + Intronic
1069879158 10:71580957-71580979 CAGGGGAGCAGGTGGACAGCAGG + Intronic
1070109193 10:73466077-73466099 AAGTGAAGATGGAGAACAGTAGG - Intronic
1070533765 10:77360278-77360300 CAGTGGAGCTGATGATTAGCAGG + Intronic
1070604429 10:77888961-77888983 CAGTGGATAAGATGAACACCTGG + Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1072244224 10:93527123-93527145 CAGTGAAGAGGGTGGATAGCAGG - Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1072484989 10:95846491-95846513 CAGTGGAGACAGGGAACAGCTGG - Intronic
1074099303 10:110341857-110341879 CAGTGAGGATGCTGAGCAGCAGG + Intergenic
1074265641 10:111900514-111900536 TACTGGAGATGCTGAAGAGCTGG - Intergenic
1075688521 10:124380045-124380067 CAGAGGAGGTGGGGAAGAGCTGG - Intergenic
1075803173 10:125165717-125165739 CCTTGGAGATAGTGACCAGCTGG - Intergenic
1077186338 11:1237010-1237032 CACTGGAGTTTGGGAACAGCTGG + Exonic
1077279411 11:1735348-1735370 AACTGGTGATGTTGAACAGCCGG + Exonic
1078144437 11:8713267-8713289 CAGGGGAGATGGGGGACTGCAGG + Intronic
1080740899 11:35063451-35063473 CAGTGGAGATGGCAGAGAGCTGG + Intergenic
1081520370 11:43875682-43875704 GATTGGATATGGTGAACAGAAGG - Intergenic
1082105297 11:48215054-48215076 CAATGAAGATGGTAAACATCTGG + Intergenic
1083948645 11:65941279-65941301 CAGAGGAGCTGGGGAAGAGCTGG + Intergenic
1085265777 11:75237080-75237102 TAGTGGAGCTGATCAACAGCAGG + Intergenic
1085381693 11:76125544-76125566 CAGTCAGGATGGAGAACAGCTGG + Intronic
1085659420 11:78350152-78350174 CAGGGGAGATGGACTACAGCTGG - Intronic
1087219963 11:95536036-95536058 TAGTGGAGAGGGTGAAAAGGGGG + Intergenic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1088740791 11:112765333-112765355 CACTGAAGATGGTGACCAGCAGG + Intergenic
1089057518 11:115598322-115598344 CAGTGGATTTAGTGAACATCTGG + Intergenic
1089333053 11:117703388-117703410 AAGGGGAGATGGTGTCCAGCAGG - Intronic
1089434045 11:118447799-118447821 CAGTGGAGCTGGGAAACCGCTGG - Intronic
1090443181 11:126741180-126741202 AAGTGGAAATGGAGAACAGAAGG - Intronic
1091098751 11:132849738-132849760 CAGAGGACATGGTTCACAGCTGG + Intronic
1091401032 12:180823-180845 CAGAGGAGGAGGTGGACAGCAGG - Intergenic
1092087783 12:5777971-5777993 CAGAGGAGATGGGGAACAGCTGG - Intronic
1093418476 12:18947456-18947478 CAATGGAGATGGTGGACAGAGGG - Intergenic
1094042047 12:26128484-26128506 CAGCAGAGCTGGTGAACAGCTGG - Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094571476 12:31644922-31644944 CACTGGAGATGGTGGCCAGGGGG - Intergenic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095372031 12:41479476-41479498 CAGTGAAAATAGTGAGCAGCTGG - Intronic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096113511 12:49042137-49042159 CAGGTGAGATGGTGGACAGCTGG + Exonic
1096123520 12:49103831-49103853 CAGTGAAGAAGGTTAACATCAGG + Intronic
1096475156 12:51905142-51905164 CACTGAATATGGGGAACAGCTGG + Intergenic
1097188313 12:57207647-57207669 CAGTGGGAATGGTCAGCAGCTGG + Intronic
1097190207 12:57216174-57216196 CAGGGGCAAAGGTGAACAGCCGG + Intergenic
1098017025 12:66115706-66115728 CAGTGGAGATTTGGAACAGCTGG + Intergenic
1100017992 12:90035265-90035287 GAGTGGAGAGGGTGGAGAGCAGG + Intergenic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1100602891 12:96127382-96127404 CCATGGAGATGGAAAACAGCTGG + Intergenic
1101741363 12:107502648-107502670 CACAGGAGAAGGTGAGCAGCGGG + Intronic
1102778106 12:115538596-115538618 CAGTGGTGATGATAAACAACTGG - Intergenic
1103615484 12:122149105-122149127 GAGTGGAGATGGGGAAGGGCTGG - Intergenic
1103742104 12:123097837-123097859 CAGTGGGTATGAGGAACAGCTGG + Intronic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1106191211 13:27454273-27454295 CAGTAGAGCTGGAGAACATCTGG + Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110312140 13:74062821-74062843 AAATGGTGATGGTGAAAAGCTGG - Intronic
1112198835 13:97255160-97255182 AACTTGAGATAGTGAACAGCAGG - Intronic
1112967414 13:105213382-105213404 CAGTGCTCAGGGTGAACAGCAGG - Intergenic
1113787720 13:113011401-113011423 CAGTGCAGATGATGGACAGGTGG + Intronic
1113787732 13:113011462-113011484 CAGTGCAGATGGTGGACAGGCGG + Intronic
1113787761 13:113011605-113011627 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787857 13:113012096-113012118 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787873 13:113012177-113012199 CAGTGTGGATGGTGGACAGGCGG + Intronic
1113787895 13:113012300-113012322 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787921 13:113012443-113012465 CAGTGCGGATGGTGGACAGGTGG + Intronic
1113787968 13:113012689-113012711 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113928730 13:113955080-113955102 CAGTGGGGATGAGGAGCAGCTGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1118442612 14:65825975-65825997 CAGAGGAGACGGTGTGCAGCTGG + Intergenic
1118745150 14:68768064-68768086 CCCAGGAGATGGAGAACAGCCGG + Intergenic
1118882949 14:69843972-69843994 CAGTGGAGCTGGGGAAGAGAAGG + Intergenic
1119414222 14:74458904-74458926 CACTGCAGACGGTGGACAGCAGG - Intergenic
1120140455 14:80924922-80924944 CAGTGGAGATGAAGTATAGCAGG + Intronic
1120141041 14:80929922-80929944 CAGAGCAGCAGGTGAACAGCGGG + Intronic
1121139834 14:91531643-91531665 CAGTTGTGATGGTGAGCACCTGG - Intergenic
1121328984 14:93037734-93037756 CAGTGGAGATGGTGAGACTCAGG + Intronic
1126575577 15:50193159-50193181 CGGTGGAGATGAAGATCAGCTGG - Intronic
1126957632 15:53951889-53951911 CAGTGGATCTGGAGACCAGCTGG + Intergenic
1128234719 15:66059668-66059690 GAGTGGAGAGGGTGAGCAGAGGG + Intronic
1128644175 15:69362835-69362857 TGGTGAAGGTGGTGAACAGCAGG - Intronic
1128997797 15:72309604-72309626 CAGTGGTGATGGAGGACACCTGG + Intronic
1129469181 15:75740939-75740961 CACAGGAGGAGGTGAACAGCTGG - Intergenic
1130404157 15:83583288-83583310 CAGGGGACTTGGTGAGCAGCCGG - Intronic
1131075381 15:89492211-89492233 AAGGGGAGAGGGAGAACAGCTGG - Intronic
1131705034 15:94984515-94984537 CAGAGGAGAGGGTGAAGAGAAGG + Intergenic
1132083188 15:98884752-98884774 CAGTGCAGATGAGGAAAAGCAGG - Intronic
1132574781 16:659366-659388 AGGTGGCGATGGTGAGCAGCAGG + Exonic
1135070365 16:19346303-19346325 AAGTGGAGATGTTGGACAGAAGG + Intergenic
1137044511 16:35643064-35643086 CAGGGGAGATGCTGACCAGGGGG - Intergenic
1138754710 16:59469480-59469502 CAGCGCACATGGGGAACAGCTGG - Intergenic
1139538985 16:67599607-67599629 CTGTGTAGATGATGAACAGGAGG - Intronic
1139590723 16:67931435-67931457 GGGTAGAGATGGGGAACAGCGGG - Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1141118233 16:81330092-81330114 CAGTGGCAATGGTGAAGAGAAGG - Intronic
1141572877 16:84944895-84944917 CAGTGGAGTTTCTCAACAGCAGG - Intergenic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1142008010 16:87699385-87699407 CAGTGGTGATGTAGAAAAGCAGG + Intronic
1142713396 17:1735587-1735609 CAGTGGAGCCGCTGGACAGCCGG + Exonic
1143691336 17:8568769-8568791 CAGTGTTGAAGGTGAGCAGCTGG + Intronic
1144848330 17:18231477-18231499 CAGGGCTGATGGTGGACAGCAGG - Intronic
1145763581 17:27442666-27442688 CTGTGGAGATGCTGAAAGGCAGG + Intergenic
1146477055 17:33171524-33171546 CAATGGTGATGGAGAAAAGCAGG - Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146733577 17:35216904-35216926 TAGTGGAGATGGAGAAGGGCAGG + Intergenic
1146807456 17:35876340-35876362 CAGTGGTGATGGTGAAATGAAGG - Intronic
1151953864 17:77370994-77371016 CAGAGGAGATGGGAAACAGCTGG - Intronic
1152132188 17:78484407-78484429 CTGGGGAGATGGTGCACAGCTGG - Intronic
1152761159 17:82107668-82107690 CAGTGCAGCTGTTGGACAGCAGG - Intronic
1154083230 18:11278338-11278360 AAGTGGTGATGGTGACCAGAAGG + Intergenic
1155092395 18:22524552-22524574 CAGTCCAGATAGTGAACAGGTGG - Intergenic
1156007976 18:32465861-32465883 AAGGGGAGATGGTGAACGACAGG - Intronic
1156492533 18:37504933-37504955 CAGTGAGGATGGTGACCACCAGG + Intronic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1159744195 18:72210995-72211017 CAGTGAAGATGCAGAACAGTTGG + Intergenic
1159973752 18:74685350-74685372 CAGGATAGATGGTGAGCAGCTGG - Intronic
1160970349 19:1765160-1765182 TAGAGGAGATGGAGACCAGCTGG - Intronic
1161140330 19:2643396-2643418 CAGTGGACATGGTGCAGGGCCGG - Intronic
1161140356 19:2643523-2643545 CAGTGGACATGGTGCAGGGCCGG - Intronic
1161476151 19:4486753-4486775 GGGTGGAGATGGTGAAGAGGAGG - Intronic
1162531280 19:11237694-11237716 CATGGTAGAAGGTGAACAGCAGG + Exonic
1162582662 19:11540161-11540183 CAGTGGAGAGAGGGAAAAGCAGG + Intronic
1163709892 19:18840188-18840210 CAGTGGAGACGGAGGACACCGGG + Intronic
1163870175 19:19814819-19814841 CAGGTGAGATTATGAACAGCTGG + Intronic
1163929763 19:20377733-20377755 CAGACGAGATTGTGAAAAGCAGG - Intergenic
1164564432 19:29315769-29315791 CAGGGGAGAAACTGAACAGCTGG - Intergenic
1164771212 19:30810646-30810668 AGGTAGAGATGGTGACCAGCAGG - Intergenic
1165090149 19:33382730-33382752 CAGTCCAGATGTTAAACAGCTGG + Intergenic
1165307670 19:35012219-35012241 CAGGGGAGCTGGTCTACAGCCGG - Intronic
1167234555 19:48306086-48306108 CAGTGGAGGTGGGGAACTGGTGG + Intronic
1168103585 19:54153680-54153702 CAGTGGAGAGGGGGATCAGGGGG - Intronic
1168138924 19:54371769-54371791 CAGTGGAAATGGAGAAACGCAGG - Intergenic
1168159010 19:54496094-54496116 CAGTGGAAATGGAGAAACGCAGG + Intergenic
925923209 2:8651973-8651995 CAGGGGGGATGGGGAACTGCAGG + Intergenic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
927467868 2:23350669-23350691 CACTGCAGATGGTGCACCGCCGG + Intergenic
928299244 2:30110985-30111007 CAGTGGATATGCTGAACACAGGG + Intergenic
928307372 2:30181359-30181381 CGGTGGAGTTGGGGGACAGCTGG - Intergenic
929922476 2:46182408-46182430 CACTGGAGAGGGAGAACAGATGG + Intronic
930164838 2:48194808-48194830 CAGTGGGGATGGGGAAGAGCAGG - Intergenic
930316056 2:49798188-49798210 AAGTGTACATGGTGAACAGGAGG - Intergenic
931428585 2:62192573-62192595 GGGTGGAGATGTTGAACAGGTGG - Intergenic
931764387 2:65442012-65442034 CAGTGGAGATGGTGATGGGAAGG + Intergenic
932417514 2:71582588-71582610 GAGTGAAGATGGTGAAGACCTGG + Intronic
932948800 2:76269139-76269161 GAGAGGAGATGGAGACCAGCTGG - Intergenic
934902029 2:98167116-98167138 CAGGAGAGATGGTGGCCAGCGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936923335 2:117711527-117711549 GACTTGAGGTGGTGAACAGCAGG + Intergenic
937033576 2:118762178-118762200 TCGTGGAGATGGAGCACAGCTGG + Intergenic
937872147 2:126793569-126793591 CAATGGATATGGGAAACAGCAGG + Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938143352 2:128813536-128813558 CAGGGGAGAGGGTGATGAGCTGG - Intergenic
938579555 2:132633968-132633990 CAGTGGAGTTGGTGTAGAGGTGG + Intronic
939529517 2:143339804-143339826 CAGTGATGATGCTGAATAGCTGG - Intronic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
943172023 2:184414084-184414106 CAATGGAGATGATGAACCACTGG + Intergenic
943783498 2:191850459-191850481 CGGGGGAGCTGGTGATCAGCTGG - Intergenic
944911223 2:204312300-204312322 TTGCGGAGATGCTGAACAGCTGG - Intergenic
945519480 2:210806178-210806200 CAGTGGAAATGAGAAACAGCTGG + Intergenic
946704910 2:222448926-222448948 CACTGGAGATGGGGAACAGCTGG - Intronic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
1168951450 20:1804760-1804782 GACTGGAGATGGTCAGCAGCTGG + Intergenic
1170742015 20:19066443-19066465 CAGTGCAGGAGGTGAGCAGCAGG + Intergenic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1172137591 20:32697661-32697683 CAGTGGAGATGGAGCACTGGAGG + Intergenic
1172975540 20:38903214-38903236 CAGAGCAGTTGGTGAACAGGTGG - Intronic
1172977221 20:38915300-38915322 CAGTTGAGATTGTGAACAACTGG + Intronic
1174958596 20:55129885-55129907 CAAGGCAGAAGGTGAACAGCAGG - Intergenic
1176183732 20:63766811-63766833 CAGTGGAGATGGGGACCGTCCGG + Intronic
1177036682 21:16052946-16052968 CACTGAAGAAGGAGAACAGCTGG - Intergenic
1177882938 21:26715792-26715814 GAGTGGAGTTGGTGATCAGGTGG + Intergenic
1179898473 21:44376717-44376739 AAGAGGAGATGGTGAACGGGAGG + Intronic
1180120598 21:45745067-45745089 CAGTGGAGAAGGTGCCCAGAGGG + Intronic
1181298877 22:21864960-21864982 CAATGGAGAAGGTTAACAGCAGG + Intronic
1181634350 22:24167443-24167465 CATTGCAGAAAGTGAACAGCAGG - Intronic
1182421607 22:30251145-30251167 CAGAGGAGATGGTGAAGCTCAGG + Intergenic
1183781255 22:40000357-40000379 AGGAGGATATGGTGAACAGCTGG + Intronic
1184068638 22:42135112-42135134 CTGTGGTGATGGATAACAGCTGG - Intergenic
1184398432 22:44259502-44259524 CAGGGGAGCTGGGAAACAGCAGG + Intronic
1185000407 22:48242104-48242126 CATGGGAGAGGGGGAACAGCTGG + Intergenic
1185395699 22:50586527-50586549 CAGAGGAGTTGGTGAACAGCAGG + Intronic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951013880 3:17708058-17708080 CACTGGGGGTGGTGAACAGTGGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
960078302 3:113513710-113513732 TAGTAGAGATGGAGAAGAGCGGG - Intronic
962286549 3:134091139-134091161 CAGAGCAGGTGGTGAGCAGCAGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963371583 3:144407815-144407837 CAGTAGAGATGAAGAACAGCTGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963910569 3:150814065-150814087 CAAGGGACATGATGAACAGCAGG - Intergenic
965369817 3:167847987-167848009 GAGGGGAGATGGTGAAAAACTGG - Intergenic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
967359286 3:188611155-188611177 CAGTGGGGACTGTGAAGAGCTGG + Intronic
968222148 3:196947433-196947455 CAGTGGAGGTGGTGGACATGGGG - Exonic
968500542 4:947865-947887 CGGTGGCGATGATGGACAGCAGG - Exonic
968908590 4:3465552-3465574 CAGTGGAAAAGGTGCACATCGGG - Intronic
969885811 4:10214395-10214417 CATACGAGATGGTGAACAGCTGG + Intergenic
971300491 4:25438152-25438174 CAGTGCAGATGGCAAATAGCAGG - Intergenic
971496124 4:27267270-27267292 CAGTGGAGAAGGAGGTCAGCTGG + Intergenic
972963752 4:44485719-44485741 AAGGGGAGTTGGTGAACAGGTGG - Intergenic
973607471 4:52601915-52601937 CACTGGAGGTGTTGAAGAGCCGG + Exonic
973816499 4:54624360-54624382 CAGTGGAGCTGGGGAACAGCTGG + Intergenic
976764237 4:88582467-88582489 AAGGGAAGATGGGGAACAGCAGG - Intronic
978141957 4:105328163-105328185 CAGTGGAAATAGAAAACAGCTGG - Intergenic
978195810 4:105970536-105970558 TAGTGCATATGGAGAACAGCTGG - Intronic
978372882 4:108046842-108046864 CGGTGCAGCTGGGGAACAGCTGG - Intergenic
978485062 4:109243634-109243656 CATTGTAGATAGAGAACAGCTGG - Intronic
978881391 4:113707428-113707450 AAATAGAGATGGAGAACAGCTGG - Intronic
978903366 4:113979374-113979396 AAGTGGAGAAGGTGATCAGGAGG - Exonic
979108914 4:116725115-116725137 AAGTGGAGATGGCGAAAAGTAGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980418536 4:132526275-132526297 CATTGGAGGGAGTGAACAGCAGG + Intergenic
982179514 4:152736800-152736822 CAATGAAGATGGAAAACAGCTGG + Intronic
983274091 4:165596564-165596586 CAGTGGAGTTGGGGAACAAGAGG + Intergenic
984367198 4:178814587-178814609 CTGTGGAAATGAAGAACAGCTGG + Intergenic
984514863 4:180725600-180725622 CAGTAGAGATGGAGGACAACAGG + Intergenic
986184794 5:5425158-5425180 CAGTGGAGATGTTGAAAAGTGGG - Intronic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
987690860 5:21265145-21265167 CAGTGTACATTGAGAACAGCTGG - Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988509102 5:31850983-31851005 CTGTAGAGATGATGAACAGCTGG + Intronic
991319182 5:65350276-65350298 CAGTGAAGATTGAGAACATCTGG + Intronic
991592118 5:68264207-68264229 CAGAGGTGATGGTGAAAAGCTGG + Intronic
992009321 5:72511019-72511041 TAGTGGAGATGGGGAGCCGCTGG - Intergenic
995865574 5:116686629-116686651 CGGAGGAGAAGGGGAACAGCAGG + Intergenic
996030420 5:118698805-118698827 AAGTGGATATGGGGAATAGCAGG + Intergenic
996945502 5:129062276-129062298 GCGTGGAGATGCTGAACAGAGGG + Intergenic
1000790907 5:165605987-165606009 CAGTGGTAATGGTGAGCAGAAGG - Intergenic
1001680375 5:173552728-173552750 GAGTGGAGATGGAGAACAGCTGG - Intergenic
1001761932 5:174214637-174214659 CAGGGAAGAAGGTGAGCAGCAGG + Intronic
1002798524 6:497471-497493 CTTTGGAAATGGTGAACACCTGG + Exonic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1002980750 6:2134558-2134580 CAGTGTAGAAGCTGAAAAGCAGG + Intronic
1003682399 6:8269040-8269062 CAGTGGTGATGGAGAAAACCAGG + Intergenic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1005593044 6:27348486-27348508 CAGTGGTGGTGGTGGTCAGCTGG - Intergenic
1007142853 6:39593576-39593598 CAGTGTAAATGGCTAACAGCTGG + Intronic
1007298147 6:40844399-40844421 CACAGGAAATGGAGAACAGCAGG + Intergenic
1007924216 6:45638461-45638483 CATTCAAGATGGTGAACAACTGG + Intronic
1010935470 6:81855646-81855668 CAGTGGGGATGGTAAATACCCGG + Intergenic
1012099103 6:95007617-95007639 CAGTGTGGATTATGAACAGCAGG - Intergenic
1013732538 6:113185417-113185439 ATGTGGGGATGGTGAAGAGCTGG + Intergenic
1014886074 6:126782976-126782998 TAGTGGAGTTGGGGAACAGCTGG + Intergenic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1016980545 6:149850013-149850035 CCGTGCAGATGGTGGAGAGCAGG + Intronic
1018593829 6:165456514-165456536 CAAAAGAGATGGAGAACAGCTGG - Intronic
1019487813 7:1297313-1297335 CAGGAAAGATGGGGAACAGCTGG + Intergenic
1020641135 7:10755204-10755226 CACTGGAGAAGATGACCAGCAGG - Intergenic
1020687536 7:11314051-11314073 CAGGGTAGAGGGTGAGCAGCTGG - Intergenic
1020824735 7:13012634-13012656 CAATGGATATGGTGAAGAACAGG - Intergenic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1023221463 7:37923280-37923302 CGATGGAAATGGTGAACAGGGGG + Intronic
1026393914 7:69931709-69931731 GAGTGCAGATGGGGAAAAGCAGG - Intronic
1030109853 7:106017901-106017923 CAGTGGAGATGGAGTACAGGAGG - Exonic
1031872127 7:127099422-127099444 AAGTGGGGCAGGTGAACAGCAGG + Intronic
1033930206 7:146510081-146510103 GAGGGGAGCTGGTGAACAGGTGG + Intronic
1034255936 7:149724712-149724734 CTGTGAAGATGGAGAACAGCTGG + Exonic
1035212039 7:157336174-157336196 GCGTGTAGATGGTGACCAGCAGG - Intronic
1035777474 8:2199379-2199401 CAGTGGAGGTGATGGACAGCCGG + Intergenic
1036601499 8:10264955-10264977 CACTGGAGCTGGGGTACAGCTGG + Intronic
1036757639 8:11481783-11481805 CAATGGAGATGGGGAAAAGTGGG + Intergenic
1037883327 8:22583352-22583374 CAGTGGGCAGGGTGCACAGCTGG + Intronic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039532537 8:38276368-38276390 ATGTGGAGATGGTGGAGAGCTGG - Exonic
1039793429 8:40893084-40893106 TGCTGGAGATGGAGAACAGCTGG + Intronic
1040837443 8:51747204-51747226 CAGTGGAGAGGGTGGGCACCAGG - Intronic
1042202137 8:66289404-66289426 TTGTGGAGATGGTAGACAGCTGG - Intergenic
1042388470 8:68204576-68204598 CAGCAGAGATGGGTAACAGCTGG - Intronic
1042719596 8:71813070-71813092 CAGTGAGGATGGTGAACGGAAGG - Intergenic
1043149109 8:76691135-76691157 TTGTGGAGATGGTGAAGAGTTGG + Intronic
1043173197 8:76991398-76991420 CAGTGTAGATTAGGAACAGCTGG + Intronic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044113192 8:88302463-88302485 CAGTGGAGAAGGAGTACAACAGG - Intronic
1045040428 8:98218895-98218917 CAGTGTTGATGACGAACAGCAGG + Intronic
1045040548 8:98219742-98219764 CAGTGTTGATGATGAACAGCAGG - Intronic
1045073609 8:98538527-98538549 CATTGGAGATTGAAAACAGCTGG - Intronic
1045767277 8:105688977-105688999 CAGTGTAGAAGGTGAATAGTAGG - Intronic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046421822 8:113995303-113995325 CAGTAGAAATGGAAAACAGCTGG - Intergenic
1047513638 8:125534708-125534730 CAGGAGAGATGGTGCCCAGCAGG + Intergenic
1047667113 8:127104228-127104250 CAGAGGAGGTTGTGAAGAGCAGG + Intergenic
1048264152 8:132970923-132970945 CATTGGAGATGCTGCCCAGCAGG + Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1049289647 8:141795052-141795074 CAAGGGACATGGTGACCAGCAGG - Intergenic
1050220794 9:3387458-3387480 CAGTAGAGATGGTCAACAAAAGG + Intronic
1050648515 9:7748694-7748716 CAGTGAAGACAGAGAACAGCAGG + Intergenic
1051141357 9:13982641-13982663 AAATGGAGGTGGTGAACAGCTGG - Intergenic
1053255537 9:36614062-36614084 CAGTGGAGGTGGTAAAAAGTGGG + Intronic
1056771562 9:89481339-89481361 CAGAGGAGAGGGTTCACAGCAGG + Intronic
1057181023 9:93030445-93030467 GAATGGAGATGGTGTGCAGCTGG - Intronic
1058638451 9:107059442-107059464 CAGCAGAGATGCTGAACAGTAGG + Intergenic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1060959233 9:127667615-127667637 CATGGGAAATCGTGAACAGCTGG - Intronic
1187339954 X:18412143-18412165 CAGTGGAGATGGTAAATAAATGG - Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188535065 X:31187869-31187891 CAGTGGAGAGATCGAACAGCTGG - Intronic
1188602964 X:31992045-31992067 AAGTGGAGAGTGAGAACAGCAGG + Intronic
1189103992 X:38218979-38219001 CAGTGGAGGTGGTGGCAAGCAGG + Intronic
1189483888 X:41414290-41414312 CATAGGAGGAGGTGAACAGCCGG + Intergenic
1189672348 X:43424447-43424469 CAGTGGAGATGGGGAATTACAGG + Intergenic
1190876786 X:54465741-54465763 CCGTGGAGCTGGTCAACACCTGG - Exonic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1192221598 X:69200936-69200958 CAGTGAAGATGGAAAACAGCTGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1196264416 X:113625735-113625757 CAGTGGAGTTGGTGAAACGCTGG + Intergenic
1198889513 X:141377427-141377449 CAGAGGTCATAGTGAACAGCAGG + Intergenic
1199089551 X:143675514-143675536 AAGCAGAGATGGTGAACAGGTGG + Intergenic
1199447325 X:147940471-147940493 CACAGGATCTGGTGAACAGCAGG - Intronic
1199907480 X:152248237-152248259 AAGTGGATTTGGTGAACAGTTGG - Intronic
1200563879 Y:4740439-4740461 CAGTGCATCTGGTGCACAGCGGG + Intergenic
1202036692 Y:20643740-20643762 CAGTGCAGCTGCTGAACACCGGG + Intergenic