ID: 916489508

View in Genome Browser
Species Human (GRCh38)
Location 1:165289055-165289077
Sequence GAGGCTGGAGTCTCTGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916489508_916489516 9 Left 916489508 1:165289055-165289077 CCCACACCAGAGACTCCAGCCTC 0: 1
1: 0
2: 3
3: 22
4: 292
Right 916489516 1:165289087-165289109 TGCCTTCATCTAATCTTTTGTGG 0: 1
1: 0
2: 0
3: 24
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916489508 Original CRISPR GAGGCTGGAGTCTCTGGTGT GGG (reversed) Intronic
900097167 1:944595-944617 GAGGCTGGCGTCTGTGCAGTTGG - Exonic
900278967 1:1853062-1853084 GAGGCTTGAGTCTGTGCTGCAGG - Intronic
900372910 1:2340161-2340183 GAGGCTGCTGTCCCTGGGGTAGG + Intronic
901246811 1:7738207-7738229 AATGCTGCAGTCTCTGGAGTGGG - Exonic
902242766 1:15099830-15099852 GCTGCAGGCGTCTCTGGTGTGGG - Intronic
902367164 1:15983734-15983756 TAGGCTGGAGACTCTGGAGATGG - Intergenic
904600886 1:31672078-31672100 GGGACTGGAGGCTCTGGGGTTGG + Intronic
905408368 1:37752757-37752779 GAGGATGGCTTCTCTGGGGTGGG + Intronic
905788485 1:40776625-40776647 GGGGCTGGAGTCTCAGGGATTGG - Intergenic
905908540 1:41638036-41638058 GACGCTGGAGGCTCTGAAGTTGG + Intronic
909273117 1:73649697-73649719 GGGTCTGGAGTGTCTGATGTGGG - Intergenic
911021839 1:93397016-93397038 GTGGCTGCAGTCACTGGTGAGGG - Intergenic
911335065 1:96572867-96572889 GAGGCAGGAGTCCCTACTGTGGG + Intergenic
911766054 1:101676325-101676347 GAGGCTGGAGTGTCAGGTAACGG - Intergenic
913251125 1:116912524-116912546 GAAGCTGGAGTCTGTGGTACGGG - Intronic
913349503 1:117842318-117842340 GAGCCTGGAGGGTTTGGTGTGGG + Intergenic
913961773 1:143344433-143344455 GAGGCTGGAGACATTGGCGTGGG - Intergenic
914056128 1:144170005-144170027 GAGGCTGGAGACATTGGCGTGGG - Intergenic
914123018 1:144796357-144796379 GAGGCTGGAGACATTGGCGTGGG + Intergenic
916475193 1:165162391-165162413 CAGGGTGCAGTCTCTGGGGTTGG - Intergenic
916489508 1:165289055-165289077 GAGGCTGGAGTCTCTGGTGTGGG - Intronic
917968770 1:180194412-180194434 AAGGCTGGAGTCACTTGTGGGGG + Intronic
919730165 1:200908750-200908772 GGGGCTGGAGACTCTGGAGGAGG - Exonic
921874301 1:220176834-220176856 GAGGCTGGTGTGTCTCATGTTGG - Intronic
922028108 1:221772029-221772051 GGGGCTGGAATCTGTGGGGTAGG - Intergenic
923765377 1:236888254-236888276 TAGGCTGGAGTCTAAGGTGTTGG - Intronic
923993867 1:239469947-239469969 CTGGCTGGAGTCTCAGGTGAAGG + Intronic
924385391 1:243494962-243494984 GAGGCTCCACTCTCTGCTGTTGG + Intronic
1063848662 10:10160861-10160883 GAGGCTGGAGCCTCTGCTTATGG + Intergenic
1064193614 10:13228031-13228053 GACACTGGACTCTCTGGTCTAGG + Intronic
1065639657 10:27768783-27768805 GAGGCTGGAGTTTGTGATATGGG - Intergenic
1067428419 10:46226484-46226506 GAGGCTCGAGCCCCTGGTGGTGG + Intergenic
1069566673 10:69468092-69468114 GGGGCTGGAGTCTCATGGGTGGG - Intronic
1071240955 10:83704221-83704243 GAGGCTGGAGACTCCTTTGTGGG + Intergenic
1071574389 10:86715150-86715172 GAGGCTGGAGTATGGGGTGGGGG + Intronic
1071721405 10:88150179-88150201 GAGGCCAGAGTCTCTGGAGGTGG - Intergenic
1071785848 10:88898992-88899014 GTTGCTGGAGTTGCTGGTGTTGG + Intronic
1073214261 10:101828019-101828041 GAGGCTGGAGGCTCTGAGGAAGG - Intronic
1073479254 10:103775872-103775894 GTGGCTGGAGTCTCTGGGATGGG + Intronic
1073594619 10:104787316-104787338 GATGCTGGAGTCTCTGTTGAGGG + Intronic
1073607093 10:104907475-104907497 GAGGCTGAAGTATATGGGGTTGG - Intronic
1073783561 10:106864925-106864947 GTGGCTGGAGACCCTGGTTTGGG - Intronic
1074325608 10:112447562-112447584 GAGGCTGGAGTGGGTGGTGCCGG + Intronic
1075317266 10:121462806-121462828 GAGTCTAGAGTCTCTGGCTTGGG + Intergenic
1075395336 10:122122991-122123013 GAGGTTGGCCTCTCTGGTTTTGG + Intronic
1075709679 10:124523929-124523951 GAGGCTGTGGCTTCTGGTGTAGG + Intronic
1076252625 10:128996098-128996120 GAGGCTGGGGTCCCTGGGCTGGG - Intergenic
1077082907 11:733164-733186 GAGGCTGGAGTCTGAGATGCAGG - Intergenic
1077161372 11:1114090-1114112 GAGGCCGGAGTCTGAGGTGCAGG + Intergenic
1077230039 11:1454661-1454683 GAGGCTGGATTCTCGGGGCTGGG - Intronic
1077288406 11:1777758-1777780 GGGGATGGGGCCTCTGGTGTTGG + Intergenic
1077421175 11:2450749-2450771 GCGGCTGGTGTCTCTGGTACTGG + Intronic
1077441254 11:2570231-2570253 CAAGCTGGAGTTCCTGGTGTGGG + Intronic
1077441294 11:2570339-2570361 AAGGCTGGGGTTCCTGGTGTGGG + Intronic
1077489757 11:2855362-2855384 TCTGCTGGAGTCTCTGGGGTCGG - Intergenic
1082962838 11:58935101-58935123 GAGCCTGGAGTCACTGGGGCTGG + Intronic
1082976467 11:59077178-59077200 GAGCCTGGAGTCACTGGGGCTGG + Intergenic
1083047383 11:59749074-59749096 GACCCTGGGGTCTCTGCTGTTGG + Intronic
1083756003 11:64792032-64792054 GATGCTGGAGCCGCTGGTGCTGG - Exonic
1083925416 11:65803242-65803264 GAGGGTGGAGTCTGTGGTGGTGG - Intergenic
1084279810 11:68080819-68080841 GAGGCAGGGGTCTGGGGTGTTGG - Intronic
1084779545 11:71399395-71399417 GAGGCTGGAGTCCCAGATGAAGG + Intergenic
1085127462 11:74011373-74011395 GAGGCTGGCCTCTGTGGTGCTGG + Intergenic
1085717203 11:78883005-78883027 AAGGGTGGAGTCTCAGATGTGGG - Intronic
1087771971 11:102220653-102220675 GGGTCTGGAGTCTCTGAGGTTGG + Intronic
1087791204 11:102407800-102407822 GAGGCTGGAGTCAGAGGTGAAGG - Intronic
1089624962 11:119745445-119745467 GAGGCTGCAGGCTCTGTAGTGGG + Intergenic
1090135799 11:124198427-124198449 AAGGGTGGAGTCTCTGGCGAGGG + Intergenic
1090207554 11:124894239-124894261 GTGGCTGCAGTCACTGGTGCTGG - Exonic
1090973986 11:131666681-131666703 GAGGCTGAGGACTCTGTTGTGGG - Intronic
1091310407 11:134571369-134571391 GAGGCTGGAGTCTTGGCTCTGGG - Intergenic
1091556068 12:1574402-1574424 GAGGCTGGCGGCAGTGGTGTGGG + Intronic
1092953335 12:13527683-13527705 GGGGCTGCTGCCTCTGGTGTGGG - Intergenic
1094056256 12:26272452-26272474 AAGGTTGGTGTCCCTGGTGTGGG - Intronic
1094199100 12:27779682-27779704 AAGGATGGAGTCTCTGGTCCAGG - Intergenic
1095487433 12:42699661-42699683 GAGGATGGAGTCTCTGTTCAAGG + Intergenic
1096053192 12:48629008-48629030 GAGGCTGCTGTCGCTGGGGTTGG - Intergenic
1096216146 12:49798420-49798442 GAGGCTGGTGGCTCTGATGGTGG + Exonic
1099231965 12:80037171-80037193 GATGGTGGAGACTCTGGGGTGGG + Intergenic
1100928337 12:99576221-99576243 AAGTCTGGGTTCTCTGGTGTTGG - Intronic
1102785138 12:115598814-115598836 GAGGCTTCAGTGTCTGGGGTAGG - Intergenic
1103189428 12:118988444-118988466 AAGGATGCAGTCTCTGGCGTGGG + Intronic
1103908819 12:124340682-124340704 GTGGCTGGGGTGCCTGGTGTCGG + Exonic
1103968155 12:124653113-124653135 CAAGATGGAGTCACTGGTGTGGG - Intergenic
1104454527 12:128900186-128900208 GAGGCTGCTGTCTCTGGCGGTGG + Intronic
1105847694 13:24307874-24307896 GAGGCTGGAGGCGCTGCAGTCGG + Intronic
1106015225 13:25863120-25863142 CAGGGTGGGGTCTCTGGGGTGGG - Intronic
1110258594 13:73459486-73459508 GAGGCTGGAGCCAGTGGTGGGGG + Intergenic
1112498941 13:99927530-99927552 GAGGCTGGGGTAGCTGGGGTGGG - Intergenic
1113988054 13:114335045-114335067 GAGGCTGGAGACTGAGGGGTGGG - Intergenic
1114484033 14:23052597-23052619 GAGGATGGAGTATCTGGGGAAGG + Exonic
1118400249 14:65373203-65373225 GAGGGTGGAGTCCCTGGCGAGGG + Intergenic
1119552135 14:75522696-75522718 GAAGCTGGAGTCACTGCTGTCGG - Exonic
1119894516 14:78208608-78208630 GAGGCTGGAGCCTCTGGAGTGGG + Intergenic
1120218428 14:81705303-81705325 GAGGGCGGGGTCTCTGGTGAGGG - Intergenic
1120838564 14:89062950-89062972 GAGTCTTGAGTCTCGGGTCTGGG - Intergenic
1121448373 14:93992685-93992707 GAGGATGGAGGCTCTGGTCATGG - Intergenic
1121450045 14:94001281-94001303 GAGCCTGGAGTCTCTGGAGGAGG + Intergenic
1121495664 14:94390046-94390068 GGGGCTGGTGTCACTGGGGTGGG + Intronic
1122405268 14:101497051-101497073 AAGACTGGGGTCTCTGGTCTGGG - Intergenic
1122788950 14:104176396-104176418 GAGGCTGGAGTGGATGGTCTGGG - Exonic
1124648111 15:31454166-31454188 GAGGCCGGGGTCTCGGGTGGCGG - Intergenic
1124655906 15:31507108-31507130 GATGCAGGAGTAACTGGTGTCGG + Intronic
1126799818 15:52288739-52288761 GAGGCAGGAGTCTGTGGACTGGG + Intronic
1126928049 15:53612924-53612946 GGGGATGGAGTTGCTGGTGTAGG + Intronic
1127063709 15:55215192-55215214 GAGGCTGGAGACTCTGGAGTTGG - Intronic
1127427054 15:58867134-58867156 GAGGCTGGAGTCACCAGTGGTGG + Intronic
1129129867 15:73483979-73484001 GGGGCTGGAGGCTGTGGAGTAGG - Intronic
1130963126 15:88678203-88678225 GAGGCTGGAGTGAATGGTGCAGG - Intergenic
1130994899 15:88898210-88898232 GAGGCTGGAGACTTTGGTCCAGG - Intergenic
1131059423 15:89395502-89395524 GAGGCTGGAGTCCCTTGCTTTGG - Intergenic
1132554611 16:567016-567038 GTGGCTGCAGCCTCTGTTGTTGG - Exonic
1134809116 16:17151925-17151947 GAGGCTGGAGTACCTGGGCTTGG + Intronic
1138389390 16:56658983-56659005 GTGGCTGGAGGCTCTGTTGGGGG + Intronic
1138830596 16:60369880-60369902 GAGTCTGGAGGCTCTGGACTTGG - Intergenic
1139112153 16:63904694-63904716 GAGGCTGGATCCACGGGTGTGGG + Intergenic
1139351249 16:66337420-66337442 AAGGCAGGACTTTCTGGTGTGGG + Intergenic
1140083967 16:71777478-71777500 GAGGGTGGCGGCTCTGGTGCAGG + Intronic
1140650458 16:77082621-77082643 GATGCAGGTGTCTCTGGTGATGG + Intergenic
1140737971 16:77915638-77915660 GAGGCAGGAGGCCCTGTTGTTGG + Intronic
1142883222 17:2896902-2896924 CCGGCTGGAGTCTCTGCTGCAGG - Intronic
1144734165 17:17545576-17545598 GAGGAGGCCGTCTCTGGTGTAGG - Intronic
1146688904 17:34859648-34859670 GAGGCGGCAGTCTCAGTTGTGGG - Intergenic
1146692953 17:34889341-34889363 GATCCTGGAGTCTCTGTTCTAGG + Intergenic
1146696378 17:34911717-34911739 GAGGCTGGAGAGGCAGGTGTGGG + Intergenic
1147675911 17:42205461-42205483 GAGGCTGGAGCCTCTTGAGCAGG - Intronic
1148714454 17:49705990-49706012 GAGGCTGAGGTCTCTGGTGCAGG - Intronic
1149153565 17:53598718-53598740 GAGGCTGCAGTTTGTGATGTAGG - Intergenic
1150158063 17:62870797-62870819 GAGTCTGGATTTTCTGGTTTGGG - Intergenic
1150487566 17:65554517-65554539 GAGGATGGAAGCTCTGGTGAGGG - Intronic
1151097456 17:71514879-71514901 GTGACTGGAGTCTCTGGTGCAGG + Intergenic
1151267482 17:72967980-72968002 GAGGCTGGGGTCTGGGGTGGAGG - Intronic
1151700043 17:75737938-75737960 GAGGCTGGGGACCCTGGTGGGGG - Intronic
1151785933 17:76275080-76275102 GAGGGTGGAGGCTCTGGTTGGGG + Intronic
1152577480 17:81149250-81149272 GGGGCTGGAGGCTGTGGTGGTGG - Intronic
1152814458 17:82399217-82399239 GAGGCTGGAGACTCTGCAGAGGG - Intronic
1153748067 18:8200529-8200551 GAAGTTGGAGTCTCTGTTCTGGG + Intronic
1155142215 18:23053832-23053854 GGGGCTGGTGTCTCTGAGGTTGG + Intergenic
1156246736 18:35307506-35307528 CAGTGTGGATTCTCTGGTGTAGG - Intergenic
1156496466 18:37529023-37529045 GAGGATGGAGGCTCTAGGGTAGG + Intronic
1157448898 18:47770854-47770876 GAGGCTGGAGCCTCCGGAGGTGG + Intergenic
1157648178 18:49299443-49299465 GAAGAAGGAGTCTCTGGTGGTGG - Intronic
1157981544 18:52387497-52387519 GAAGCTGGTGTCTCTGCTGCTGG - Intronic
1159119721 18:64154747-64154769 GAGAATAGAGACTCTGGTGTTGG + Intergenic
1160585056 18:79909553-79909575 AAGGCTGGGGACTCTGGTGAGGG - Intronic
1161156583 19:2734976-2734998 GAGGCTGGGGGCTCGGGAGTAGG + Intronic
1161251092 19:3280755-3280777 GAGACTGGAGTTTCAGGTGTGGG + Intronic
1161768775 19:6220446-6220468 GAGGCTGGAGTTGCTGGAGGAGG - Intronic
1163296979 19:16418723-16418745 GAGGGTGGAGCCTCAGGAGTGGG + Intronic
1163689987 19:18733278-18733300 AGGGCTGGAGTCTCTTTTGTGGG + Intronic
1165336326 19:35172569-35172591 GAGGCCTGGGTCTGTGGTGTTGG + Intergenic
1166875655 19:45895735-45895757 GAGGCTGGACTTTCTCCTGTGGG - Intronic
1166898074 19:46036463-46036485 GAGGCTGCAGTTGCTGGTTTGGG - Intergenic
1167120476 19:47513786-47513808 GAGGCTGGAGACTCCTGGGTGGG - Intronic
1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG + Intronic
1167214422 19:48154937-48154959 GAAGGTGGAGTATGTGGTGTGGG - Intronic
1167593006 19:50414594-50414616 CAGATTGGGGTCTCTGGTGTGGG + Intronic
1168353046 19:55687373-55687395 GAGGCTGGGTGCTCTGGTGATGG + Intronic
1168513856 19:56994466-56994488 CCTTCTGGAGTCTCTGGTGTGGG - Intergenic
1202695611 1_KI270712v1_random:122690-122712 GAGGCTGGAGACATTGGCGTGGG - Intergenic
924959762 2:23746-23768 GAGGCTGGAGACTGAGGGGTAGG + Intergenic
925556085 2:5132918-5132940 AAGGCTGGAGTGTCTGTGGTAGG - Intergenic
925922596 2:8647348-8647370 GAGGCTGAAGCCGCTGGTTTGGG - Intergenic
927352442 2:22132718-22132740 GAGGCTAGAGGGTCTGGTGTGGG - Intergenic
927941231 2:27104182-27104204 GAGGCAGGAGACTGGGGTGTAGG - Intronic
933327125 2:80852347-80852369 GGGGCTGGTGTCTCTGATCTTGG + Intergenic
933837071 2:86254739-86254761 GAGGCTGGAGCCTTTTGTGTAGG + Exonic
933899590 2:86840033-86840055 GAGGCAGGAGTCTAGGGTCTGGG + Intronic
934276776 2:91579731-91579753 GAGGCTGGAGACATTGGCGTGGG - Intergenic
935281537 2:101522011-101522033 CAGGCTGGTGGCTCTGGTGCAGG + Intergenic
935780969 2:106509193-106509215 GAGGCAGGAGTCTAGGGTCTGGG - Intergenic
936953945 2:118005685-118005707 GAGGCTGCAGTGAGTGGTGTTGG + Intronic
937280301 2:120713114-120713136 GAGGCTGGCGTCTCTGCAGGAGG + Intergenic
937866564 2:126756035-126756057 GAGGCTGAAATCTCTTGTGCAGG - Intergenic
938303443 2:130231682-130231704 GAGGCTGGCGTCTGTGCAGTTGG + Intergenic
938411833 2:131071319-131071341 GAGCCTGCACTCTCTGGTGTTGG - Intronic
938453232 2:131442550-131442572 GAGGCTGGCGTCTATGCAGTTGG - Intergenic
943203566 2:184860880-184860902 GAGTCTTGGGTCTCTGGGGTTGG + Intronic
944644380 2:201763521-201763543 CTGTCTGGAGACTCTGGTGTGGG - Intronic
947563237 2:231176349-231176371 GAAGCTGGGGTTTCTGGTGTAGG - Intergenic
948123849 2:235550531-235550553 GAGTCTGGAGTCGCAGGTGTGGG - Intronic
948240487 2:236429222-236429244 GCAGCTGGAGTCTGTGATGTTGG + Intronic
948621137 2:239235472-239235494 GAGGCCTGGGTCTCTGGTTTTGG - Intronic
948874419 2:240819427-240819449 GGAGCTGGGGTCTCTGGCGTGGG + Intronic
1170569650 20:17625574-17625596 GGAGCTGGAGTCCCAGGTGTCGG - Exonic
1170732659 20:18988151-18988173 GTGCCTGAAGTGTCTGGTGTGGG + Intergenic
1170738073 20:19027842-19027864 GAGGATGGAGTCTGTGGTATTGG + Intergenic
1171109892 20:22471387-22471409 GAGGCTGAAGTCTGAGATGTAGG + Intergenic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1172596822 20:36155535-36155557 GAGGCTGGGGTCTCAGGGATGGG + Intronic
1172617314 20:36297910-36297932 GAGGCTCCAGTATCTGGTATGGG - Intergenic
1173645716 20:44631969-44631991 GAGGCGCCCGTCTCTGGTGTGGG - Intronic
1176205826 20:63887635-63887657 GAGCCGGGTGTCTCTGGTGGGGG + Intronic
1177062081 21:16388602-16388624 GAGCCTGGAATTTTTGGTGTCGG + Intergenic
1178084129 21:29095345-29095367 GAGGCAGGAGCCTTTTGTGTGGG + Intronic
1178699299 21:34819804-34819826 GAGGCTGGAGCCACAGCTGTGGG - Intronic
1179308024 21:40172571-40172593 GAGGCTTGAGTCTCAGCTCTGGG - Intronic
1179708286 21:43194922-43194944 AAGGCTGGAGTCTGAGGTCTGGG + Intergenic
1179833305 21:44012039-44012061 GAGGCCGGCGTCTCTGGTCCGGG + Intergenic
1179907990 21:44434097-44434119 GAGGATGGAGTCTAGGCTGTGGG + Intronic
1180637081 22:17269829-17269851 GGGCCTGGAGTCTTGGGTGTGGG + Intergenic
1182028966 22:27142556-27142578 GGTGCTGCAGTCACTGGTGTGGG + Intergenic
1182127851 22:27829222-27829244 TGGGCTGGATTCTCTGGGGTGGG - Intergenic
1182570204 22:31231557-31231579 CAGGCTGGAGTCTCTTGTAGGGG - Intronic
1182692803 22:32175751-32175773 CCGGCTGGAGTCTCTGCTGCAGG - Intergenic
1183395356 22:37568302-37568324 GGGGCTGGAGTCTCAGCTGCAGG - Exonic
951593819 3:24295730-24295752 GAGGCTTGGGTCTCAGGTCTAGG + Intronic
951952634 3:28217353-28217375 GAGGCACGAGTCACTGGTCTTGG + Intergenic
952611623 3:35216684-35216706 GCAGCTGGAGACTCTGGTCTAGG - Intergenic
952820720 3:37483561-37483583 GTGGGTGCAGTCTCTGGGGTGGG + Intronic
952925429 3:38316336-38316358 GGGGCTGGTGTCTCTGGCCTCGG + Exonic
954391123 3:50268629-50268651 GAGGCTGGAGCCAAGGGTGTGGG - Intronic
956256791 3:67291811-67291833 GCGGCTGCAGGCTCTGCTGTGGG - Intergenic
956260129 3:67330102-67330124 GTGGCTGGAGTCTCAGCTGAGGG + Intergenic
958454693 3:94315886-94315908 GAGGCTGGAAAGTCTGATGTGGG + Intergenic
963069676 3:141292637-141292659 GAGCATGGAGTCTATGGGGTTGG - Exonic
964313072 3:155414773-155414795 GAAGCTGGTGCCTCTGGTCTAGG - Intronic
964514182 3:157489308-157489330 TAGGCTGGAGTTTCTGAGGTCGG - Intronic
965469222 3:169069958-169069980 GAAGCTGGATTATTTGGTGTGGG + Intergenic
967524873 3:190480276-190480298 GATGCTGGAGTCACATGTGTGGG + Intergenic
968019080 3:195367813-195367835 GTGGCTGGAATGACTGGTGTTGG - Intronic
968466497 4:754189-754211 CAGGCTGGGGGTTCTGGTGTGGG + Intronic
969033989 4:4236657-4236679 GAGGCTGGAGACATTGGCGTGGG + Intronic
969227245 4:5807055-5807077 GAGGCTGGAGTCTGGAGTGCTGG + Intronic
969275758 4:6134834-6134856 TAGGCTTGAGGCTCTGGTGGGGG - Intronic
972511166 4:39770037-39770059 GAGGCTGGGGTCCCTGGGCTAGG - Intronic
975655531 4:76637804-76637826 GAGACTGGAGTCCTTGGTTTTGG - Intronic
975864368 4:78711404-78711426 AAGGCAGGAGTCTCAGGAGTAGG + Intergenic
976164875 4:82244027-82244049 GAGGCTGCAGTCTCAGCTGAAGG + Intergenic
977697355 4:99981554-99981576 TAGGTTGGATTCTCTGGTGTTGG - Intergenic
981265027 4:142772313-142772335 GAGGCGTGTGTCTCTGGGGTGGG + Intronic
982780657 4:159487755-159487777 GAGGCTGGCCTCTCTGTTCTGGG - Intergenic
982798539 4:159673811-159673833 GAGGGTGGGGTCTCTGATGAGGG + Intergenic
984096226 4:175438098-175438120 GAGGCTGGAGTCTCAGGTGCTGG + Intergenic
985469440 5:29756-29778 GAGGCTGGAGACTGAGGGGTGGG + Intergenic
985570671 5:643116-643138 GAGGCAGGAGGCTCAGGAGTTGG + Intronic
985625109 5:981805-981827 CAGGCTGGGGTCTCTGCTGGGGG - Intergenic
988470340 5:31531910-31531932 GGGGCTGGAGTCTCCGGGGCTGG - Intronic
991654090 5:68885561-68885583 CAGGCTGGACTCTCAGGTGTTGG - Intergenic
993014945 5:82524745-82524767 GAGGCTGGAGGCTCTGGGCTAGG + Intergenic
993268663 5:85763250-85763272 TGGCCTGGAGACTCTGGTGTTGG - Intergenic
994562822 5:101397986-101398008 AAGGCCAGAATCTCTGGTGTGGG + Intergenic
994952534 5:106482835-106482857 GAGGGTGGGGTCTCTGGCATTGG - Intergenic
996340834 5:122437366-122437388 ATGGCTAGAGTCTCTGGTTTTGG - Intronic
996470279 5:123852461-123852483 GAGGCTGGAGAGTCTAGTTTTGG + Intergenic
997282736 5:132658962-132658984 GAGCATGGACACTCTGGTGTTGG - Intronic
997437571 5:133886054-133886076 GAGGCTGGTGTGGCTGGAGTGGG - Intergenic
999117661 5:149177997-149178019 GATGCTGGAGTCACTGGGCTGGG - Intronic
999177568 5:149642061-149642083 CACCCTGGAATCTCTGGTGTGGG - Intergenic
1000025535 5:157355788-157355810 AAGCCTAGAGTCCCTGGTGTGGG + Intronic
1000258468 5:159563153-159563175 AAGACTGAAGTCTCTGGAGTAGG + Intergenic
1001057043 5:168458317-168458339 GAGGCTGCAGGCTTTGGAGTTGG - Intronic
1005679175 6:28188646-28188668 CAGTGTGGATTCTCTGGTGTTGG - Intergenic
1005704115 6:28434734-28434756 CAGTGTGGAGTCTCTGGTGCTGG + Exonic
1005996505 6:30934498-30934520 GGGGATGGAGATTCTGGTGTTGG + Intergenic
1006811283 6:36822075-36822097 CAGGCTGGTGTTTCTGGTGTGGG + Intronic
1010114751 6:72290408-72290430 CAGACAGGAGTCTCTGCTGTTGG + Intronic
1011010514 6:82698369-82698391 GAAGCTGAAGTCTCAGGTCTGGG - Intergenic
1011396779 6:86918656-86918678 GAGGCTTTAGTTTCTGGTGAGGG - Intergenic
1011571115 6:88736988-88737010 GAGGCAGGAGTCTATGGAGGTGG + Intronic
1015089258 6:129334839-129334861 GAGGCTGGAGCCTCATGAGTGGG - Intronic
1017027802 6:150197110-150197132 CTGGCTGGAGTCTCTGTTGAAGG + Intronic
1017443962 6:154490656-154490678 GAGGCTGGAGAGTCGGGAGTGGG - Intronic
1019521457 7:1462349-1462371 TAGGCTGGTGTCGCTGGTGCAGG + Intergenic
1019532533 7:1510958-1510980 GAGGCTGGAGCCCCCGGTCTAGG - Intergenic
1023041384 7:36175978-36176000 GAGGCTGCAGGCTGTGGCGTGGG + Intronic
1023843831 7:44110322-44110344 GATGCTGGAGTCTCTGCCCTGGG - Exonic
1026831446 7:73612707-73612729 GAGGATGGGGTCTCTGGGCTGGG - Intronic
1027188818 7:75986498-75986520 CAGGCCGGAGTCTGTGGGGTGGG - Exonic
1027348752 7:77288789-77288811 GAGCCCACAGTCTCTGGTGTGGG - Intronic
1028288610 7:89036775-89036797 GAGTCTGAAGTAGCTGGTGTTGG + Intronic
1028522565 7:91747862-91747884 GAGGATGGAGTTTCTGATGGTGG - Intronic
1029422673 7:100479216-100479238 GAGGCAGGACTTCCTGGTGTGGG - Exonic
1029475555 7:100781689-100781711 CAGGCTGGAGTCTATGATCTCGG + Intronic
1029709797 7:102293310-102293332 GTGGCTGGGGTCTCTTGTCTGGG + Intronic
1029923198 7:104287840-104287862 GAGGCTGGAGGGTCAGGAGTTGG - Intergenic
1030066729 7:105665234-105665256 GAGGCTGGAGACACTGGAGAGGG + Exonic
1030900008 7:115111705-115111727 GTGGCTGTATTCTGTGGTGTTGG - Intergenic
1032013512 7:128361481-128361503 GAGGCTGCGGTCTCTGGACTAGG - Intronic
1033678030 7:143563584-143563606 GAGGCTGGAGCCTGTGCTTTGGG + Intergenic
1033693809 7:143765860-143765882 GAGGCTGGAGCCTGTGCTTTGGG - Intergenic
1035336055 7:158127556-158127578 GAGGCTTGAGTCTGGGGTGGCGG - Intronic
1035520361 8:271267-271289 GAGCCTGCAGGCTCTGGTGTGGG - Intergenic
1036595412 8:10207294-10207316 GAGGCTGGTGTCTTTGGCCTGGG + Intronic
1037567037 8:20126713-20126735 CATGCTGGAGCCTCAGGTGTGGG - Intergenic
1037802281 8:22042393-22042415 GGGGCTGGGGTCTCTGGTTCTGG - Intronic
1038057504 8:23874522-23874544 AGGGCTGGAGTCTCAGCTGTGGG + Intergenic
1041078589 8:54191819-54191841 GTGGCTGTAGGCTCTGCTGTGGG - Intergenic
1041527313 8:58821921-58821943 GAGTCTGTAGTCTCTGGGGCGGG - Intronic
1041808974 8:61886912-61886934 GTGTCTGGAGTCACTGGGGTTGG + Intergenic
1042367365 8:67952514-67952536 CACGCTGGAGTTCCTGGTGTCGG + Exonic
1045599167 8:103693762-103693784 GATCCTGGAGCCTCTGTTGTGGG + Intronic
1045878842 8:107014656-107014678 GAGCCTGGAGCCACTGGGGTTGG - Intergenic
1049826299 8:144670977-144670999 GTGGTGGGGGTCTCTGGTGTGGG - Intergenic
1052745096 9:32432881-32432903 GGGGCTGCAGTCTCTGGAGGAGG + Intronic
1056966429 9:91166350-91166372 CAGGGTGGAGTCTCTGTTGCTGG - Intergenic
1058042247 9:100315415-100315437 GAATCTGGATGCTCTGGTGTTGG + Intronic
1060680250 9:125556363-125556385 GAGGCTGGGGAATCTGGTGTTGG - Intronic
1061087273 9:128406322-128406344 GGGGCTGGAGTCTAGGGTATAGG + Intergenic
1062024440 9:134333779-134333801 GTGGCTGGAGTCGCTGGGGTGGG + Intronic
1062309361 9:135927579-135927601 GTGGCCGGGGCCTCTGGTGTGGG - Intergenic
1062464346 9:136674574-136674596 CAGGCTGGAGTCCCAGCTGTGGG - Intronic
1062651537 9:137580271-137580293 GAGGCCGGAGTCTCAGATGAAGG - Intergenic
1186505662 X:10089996-10090018 CATGCTGGAGCCTCAGGTGTAGG + Intronic
1188273669 X:28175269-28175291 GAATCTGGATGCTCTGGTGTTGG + Intergenic
1188421943 X:30000763-30000785 GAGGCTGGTGTGTGTGGTGGTGG + Intergenic
1189450354 X:41123093-41123115 GAGGGTGGGGTCCCTGGTGAGGG - Intronic
1190881516 X:54495565-54495587 GGGGCTTGAGTCTCTGCAGTGGG - Exonic
1191944293 X:66514751-66514773 GAGTCTGGAGGATTTGGTGTGGG - Intergenic
1197665616 X:129220150-129220172 TAGGAAGGAGGCTCTGGTGTAGG + Intergenic
1198302100 X:135343401-135343423 GATTCTGGAGTTGCTGGTGTTGG - Exonic
1198380490 X:136078677-136078699 GAGACTGGACTCTCAGCTGTTGG + Intergenic
1199295004 X:146147026-146147048 GCTGATGGAGTCTCTGTTGTAGG + Intergenic
1200272553 X:154699419-154699441 CAGGCTGGTGCCTCTGGTCTTGG - Exonic
1201589811 Y:15602801-15602823 CTGGCAGGAGTCTATGGTGTAGG - Intergenic
1201863803 Y:18627938-18627960 GTGGCTGGAGGGTCTTGTGTAGG - Intergenic
1201869519 Y:18692440-18692462 GTGGCTGGAGGGTCTTGTGTAGG + Intergenic
1201979448 Y:19891454-19891476 GAGACTGAAGGCCCTGGTGTGGG + Intergenic