ID: 916490812

View in Genome Browser
Species Human (GRCh38)
Location 1:165300824-165300846
Sequence ATGAATGAGGAGAAGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 2, 2: 5, 3: 63, 4: 632}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916490812_916490820 18 Left 916490812 1:165300824-165300846 CCTGCCTGCTTCTCCTCATTCAT 0: 1
1: 2
2: 5
3: 63
4: 632
Right 916490820 1:165300865-165300887 GAACCCAGGTATATTACAGAGGG 0: 1
1: 0
2: 1
3: 12
4: 162
916490812_916490819 17 Left 916490812 1:165300824-165300846 CCTGCCTGCTTCTCCTCATTCAT 0: 1
1: 2
2: 5
3: 63
4: 632
Right 916490819 1:165300864-165300886 TGAACCCAGGTATATTACAGAGG 0: 1
1: 0
2: 1
3: 8
4: 115
916490812_916490817 4 Left 916490812 1:165300824-165300846 CCTGCCTGCTTCTCCTCATTCAT 0: 1
1: 2
2: 5
3: 63
4: 632
Right 916490817 1:165300851-165300873 CCCAGGATGTCTGTGAACCCAGG 0: 1
1: 0
2: 3
3: 17
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916490812 Original CRISPR ATGAATGAGGAGAAGCAGGC AGG (reversed) Intronic
900298778 1:1966190-1966212 ATGAGTGTGGAGAGGGAGGCGGG + Intronic
900536881 1:3183080-3183102 ATGACTTTGGAGATGCAGGCTGG - Intronic
900832187 1:4973261-4973283 AGGGATGAGAAGAAGAAGGCTGG - Intergenic
901174427 1:7288536-7288558 ATGGAAGAGGAGAGGCAGGCAGG + Intronic
901508387 1:9701009-9701031 AGGACTGCGGAGAAGCAGGGAGG - Intronic
902093757 1:13925562-13925584 ATGAATGAGGAGAAAATAGCAGG + Intergenic
902267008 1:15274690-15274712 AATAATGAGGAGGAGCAGGAGGG + Intronic
902752208 1:18524638-18524660 ATGAATTGGAAGAAGCGGGCAGG + Intergenic
903314150 1:22487877-22487899 ATGAATCTGGAGAGGCAGGCAGG - Intronic
903693544 1:25191465-25191487 ATGAATGATGGGAAGCAGTGAGG - Intergenic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
905055556 1:35090607-35090629 GATAGTGAGGAGAAGCAGGCAGG + Intronic
905485952 1:38296702-38296724 ATGAAACTGGAGAGGCAGGCAGG - Intergenic
905599317 1:39235394-39235416 CTGAGTCAGGAGAATCAGGCAGG + Intronic
905680721 1:39869199-39869221 CTGAAGCAGGAGAATCAGGCAGG - Intronic
905789321 1:40782149-40782171 ATGATTGAGAAGAACCAGCCAGG + Intergenic
905908675 1:41638973-41638995 AAGAAAGTGGAGAAGAAGGCTGG + Intronic
905937321 1:41834949-41834971 ATGAAGCTGGAGCAGCAGGCAGG + Intronic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
907321691 1:53606640-53606662 CTGAAAGAGGAGCAGCAGGAAGG + Intronic
907670047 1:56466395-56466417 ATGAATGATGACAAGCGGGCAGG - Intergenic
907720820 1:56970595-56970617 ATGAAACAGGAGAGGCAGGCAGG + Intergenic
907982533 1:59498222-59498244 ACAAATGAGGAGAAGTAGGCTGG + Intronic
908816312 1:68039076-68039098 ATGAATGAGGCTATGCAAGCTGG - Intergenic
909590463 1:77342852-77342874 ATGAATCAGGAGGGGCAGGTGGG - Intronic
910021792 1:82599673-82599695 ATGAATGAGGACAAGAAGGAAGG - Intergenic
910494057 1:87806290-87806312 AGGAATGAGGCCAAGCAGGGGGG + Intergenic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911319046 1:96389906-96389928 ATGAATCAGGAGAATCATGATGG - Intergenic
912519386 1:110234775-110234797 AAGAATAAGGAGAGGCAAGCAGG - Intronic
912708638 1:111933639-111933661 ATGCATGTGGGAAAGCAGGCAGG + Intronic
913022951 1:114805230-114805252 CTGATGCAGGAGAAGCAGGCAGG + Intergenic
913085592 1:115433685-115433707 ATGAATGATGACAAGGAGCCTGG + Intergenic
913377596 1:118170889-118170911 TAGAAAGAGCAGAAGCAGGCAGG + Intronic
913507134 1:119527158-119527180 ATGAGTGAGCAGAAGCAGGGTGG - Intergenic
913714402 1:121519388-121519410 CTGGAGGAGGAGAAGCAGCCGGG - Intergenic
913990678 1:143608965-143608987 AAGAATGAGAAGCAGCAGTCAGG + Intergenic
914234133 1:145792759-145792781 ATGAATGTGGATATGCAGACAGG + Intronic
914893990 1:151652090-151652112 CTGAGTCAGGAGAATCAGGCAGG + Intronic
914945887 1:152065821-152065843 ATGAAAGTGGAGAGCCAGGCAGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915240990 1:154521578-154521600 CTGACTGTGGAGAAGAAGGCAGG + Intronic
915360516 1:155283913-155283935 ATGGAGGAGGACAAGCAGGGAGG + Intronic
915366967 1:155322071-155322093 CTGAGTGAGGAGGAGCAGCCTGG - Exonic
916058143 1:161082031-161082053 TAGAATGAGGAGGAACAGGCTGG + Intronic
916270809 1:162939354-162939376 GTGAATGTGGAGAAGTAGGAAGG + Intergenic
916308047 1:163361766-163361788 ATCAATGACGAGAAGCAGGAAGG - Intergenic
916344427 1:163771782-163771804 ATGAAAGTGGAAAAGCAGGCAGG + Intergenic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916876574 1:168976231-168976253 ATGAAAGAAGTGAAGAAGGCTGG + Intergenic
916923980 1:169498341-169498363 AAGAATGAGGAGCAGAAGGCTGG + Intergenic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917006978 1:170426318-170426340 ATGGGTGAGCAGAAGCAGGGTGG + Intergenic
917166145 1:172115373-172115395 GAGAAAGAGGAGAAGCAGGAGGG - Intronic
917563091 1:176180245-176180267 ATGAATGAGTAGATACAGCCAGG + Intronic
917750836 1:178051926-178051948 AAGACTGAGAAGGAGCAGGCTGG - Intergenic
918200249 1:182259625-182259647 ATGAGTCTGCAGAAGCAGGCTGG + Intergenic
918212714 1:182365812-182365834 ATGAAGCTGGAGAAGCAGGGAGG + Intergenic
918354848 1:183697952-183697974 ATGCATGATGAGAAGCAGCTTGG + Intronic
918563866 1:185902626-185902648 ATGAATGAGGAGAAAGAGTCAGG + Intronic
919718489 1:200806429-200806451 AAAAATGTGGAGAAACAGGCAGG + Intronic
920047067 1:203140233-203140255 AGGATTGGGGAGCAGCAGGCGGG + Intronic
920580514 1:207102897-207102919 ATGAATGAGAAAGAACAGGCAGG + Intergenic
921921284 1:220672910-220672932 AGGAAAGAGGAGAAGGAGGAGGG + Intergenic
922083184 1:222318213-222318235 ATGCATGTGGAGAAGGAGGGCGG - Intergenic
922567407 1:226609993-226610015 ATGCACGAGGAGCTGCAGGCTGG + Intergenic
923793178 1:237128273-237128295 CTGAGTCAGGAGAATCAGGCAGG + Intronic
923976454 1:239270013-239270035 ATTAAAGAGCAGAAGAAGGCTGG + Intergenic
924068970 1:240255693-240255715 ATAAAGGAGAAGAAGCTGGCTGG + Intronic
924745077 1:246824302-246824324 CTGATTGAGAAGAAGTAGGCTGG - Intergenic
1063018139 10:2098678-2098700 ATGAAATAAGAGAAGCAGACAGG - Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063542594 10:6949482-6949504 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1063828911 10:9930461-9930483 GCGAGTGTGGAGAAGCAGGCGGG + Intergenic
1064070884 10:12227155-12227177 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1065960335 10:30728956-30728978 AGGAATGAGCAGAAGAAAGCAGG + Intergenic
1067014780 10:42749883-42749905 ATGAATGAGGAGGAGTCTGCAGG - Intergenic
1067120221 10:43466087-43466109 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1067719769 10:48719610-48719632 GTAAATGAGGAGAAACAGGAGGG + Intronic
1067829997 10:49606126-49606148 ATTTCTGTGGAGAAGCAGGCTGG - Intergenic
1068086072 10:52374935-52374957 AGGAATCTAGAGAAGCAGGCTGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068813531 10:61283723-61283745 AGGAATTTGGAGAGGCAGGCAGG - Intergenic
1069135037 10:64753393-64753415 ATGAGTGGGGAGAGGCAGGATGG - Intergenic
1069820306 10:71223423-71223445 ATGAAGGGAGGGAAGCAGGCAGG - Intronic
1070135308 10:73689083-73689105 CTGAAGCAGGAGAATCAGGCAGG - Intronic
1071549013 10:86551758-86551780 ATTCATGTGGAGAGGCAGGCTGG - Intergenic
1071577422 10:86739472-86739494 ATACAAGAGGAGAAGCAGGTTGG - Intergenic
1073046534 10:100642383-100642405 ATGGAGGAGGGGAAGCAGGGAGG + Intergenic
1073534685 10:104266293-104266315 CTGAATGAGAACAAGCAGACAGG + Intronic
1074524596 10:114252893-114252915 ATGAAGGAACACAAGCAGGCCGG - Intronic
1075166101 10:120069664-120069686 ATGAATTAGGAGAAGCACGGTGG + Intergenic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075642307 10:124073680-124073702 ATGAATGAGCCAATGCAGGCTGG + Intronic
1075834596 10:125443006-125443028 ATGTATGAATGGAAGCAGGCCGG + Intergenic
1076604303 10:131679241-131679263 ATAGATTAGGAGAGGCAGGCTGG + Intergenic
1077136409 11:1001571-1001593 AGGACTTAGGAGAGGCAGGCCGG + Intronic
1077836926 11:5934113-5934135 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1078501646 11:11885378-11885400 AAGAATGAAGAAAAGCAGGGTGG + Intronic
1079126392 11:17721001-17721023 ATGAAGGAGGAGGAGCGAGCAGG - Intronic
1079288718 11:19165985-19166007 TGGAAGGAAGAGAAGCAGGCAGG - Intronic
1079372337 11:19862321-19862343 AAGCAGGAGGAGAAGCAGTCTGG + Intronic
1079489128 11:20967882-20967904 ATGAATTTGGAGAAGTAGGCAGG - Intronic
1079808327 11:24962491-24962513 ATGAATGAAGTGAAGCAAGAAGG - Intronic
1079994137 11:27277479-27277501 ATGCAGGAGGAGAAGCAGTTTGG - Intergenic
1080039719 11:27746871-27746893 ATGAAGAAAGAGAAGCAGACAGG + Intergenic
1080331546 11:31145636-31145658 TTGAATGAGGAAAAGTATGCGGG + Intronic
1080417526 11:32082818-32082840 AGGAAGGAGGAAATGCAGGCAGG - Intronic
1080844163 11:36011956-36011978 ATGACTGTGGGGAAGAAGGCAGG + Intronic
1083114831 11:60450792-60450814 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1083118749 11:60491024-60491046 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083154446 11:60814577-60814599 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083263659 11:61536368-61536390 GTGAGGGAGCAGAAGCAGGCTGG - Intronic
1084375728 11:68776101-68776123 CTGAGTGAAAAGAAGCAGGCAGG + Intronic
1084502741 11:69544517-69544539 AAGGAGGAGGAGAAGCAGGCAGG + Intergenic
1084716558 11:70878006-70878028 AAGAATGCAGAGAAGCAGGAGGG + Intronic
1085179459 11:74521244-74521266 ATTAAGGAGGAAAGGCAGGCGGG + Intronic
1085258085 11:75188308-75188330 ATGAATCAAGAAAAGCAGGAAGG - Intronic
1085721116 11:78913218-78913240 ATGAAAGCAGAGAAGCAGGAAGG - Intronic
1085907135 11:80776856-80776878 ATAAATGAGGAGAATGAGGCAGG + Intergenic
1086176356 11:83895673-83895695 AAGAATGAATAGCAGCAGGCTGG - Intronic
1086276813 11:85139765-85139787 AGGAATGAAGAGATGTAGGCTGG - Intronic
1086965602 11:93024625-93024647 AAGAAGGAGGAAAAGCAGGCAGG + Intergenic
1087857749 11:103112117-103112139 TTGAATGATGAGTTGCAGGCAGG + Intronic
1088548611 11:110987419-110987441 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1088720271 11:112586034-112586056 GTGAGTGAAGAGAAACAGGCTGG + Intergenic
1088758936 11:112911267-112911289 ATTAATGTAGAGAAGCAGGATGG - Intergenic
1088826208 11:113496407-113496429 AAGAGTGAGGAGCAGAAGGCAGG + Intergenic
1089114026 11:116079474-116079496 ATGAATGAGGTGAAGAAGGGAGG - Intergenic
1089360211 11:117880593-117880615 ATGAAGCAGGAGAGGCAGGTGGG - Intergenic
1089360267 11:117881124-117881146 ATGAATGTGGAGAAGTTGGTTGG - Intergenic
1089427752 11:118393890-118393912 CTGAATTAGAAAAAGCAGGCTGG - Intronic
1089610779 11:119667333-119667355 ATGGATGAAGAGAGGAAGGCAGG - Intronic
1090297096 11:125598234-125598256 AGAAATGAGGAGACTCAGGCTGG + Intronic
1090437474 11:126698652-126698674 ATGAAAGAGAAGAAGCCAGCCGG + Intronic
1091306355 11:134538787-134538809 ATGCAGGGGGAGAGGCAGGCTGG + Intergenic
1091444845 12:538728-538750 ATCAATGAGGAGAATAAGGAAGG + Intronic
1091452547 12:582239-582261 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452551 12:582279-582301 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452555 12:582319-582341 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452564 12:582399-582421 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452567 12:582435-582457 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452573 12:582479-582501 ATGAATGGGCACAGGCAGGCAGG + Intronic
1091452576 12:582515-582537 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452580 12:582555-582577 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452594 12:582675-582697 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452597 12:582711-582733 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452600 12:582747-582769 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452604 12:582787-582809 ATGAATGAATGGACGCAGGCAGG + Intronic
1091452620 12:582907-582929 ATGAATGAATGGACGCAGGCAGG + Intronic
1092009190 12:5095379-5095401 ATGAATGTGGAGAAGTTTGCTGG + Intergenic
1092296190 12:7200789-7200811 CTGAAGCAGGAGAATCAGGCAGG + Intronic
1092575847 12:9782028-9782050 ATGAATGCACAGAAGAAGGCCGG - Intergenic
1092732236 12:11545723-11545745 ATGAATGAAGAGAAGAAGGCAGG - Intergenic
1092800995 12:12166799-12166821 ATGAATTAGGAAAATGAGGCTGG + Intronic
1093647787 12:21608384-21608406 ATGAATGAGGGGAAGCCTGGAGG + Intergenic
1094018571 12:25889930-25889952 TTTAAAGAGGAGAAGCAGGCTGG + Intergenic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094693667 12:32795340-32795362 ATGACACAGGAGAAGCAGTCAGG - Intronic
1095218465 12:39578583-39578605 ATGAATCAGGAGAATCAGAAGGG + Intronic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1096232420 12:49903852-49903874 AGGAAGGAAGAGACGCAGGCAGG - Exonic
1096317925 12:50584950-50584972 ACGAAGCAGGAGAAGCAGGCAGG - Intronic
1097216126 12:57414532-57414554 ATTAAGAATGAGAAGCAGGCCGG + Intronic
1097654404 12:62343123-62343145 AGGAATGTAGAGAAGCAGTCTGG + Intronic
1098119716 12:67223069-67223091 AGGAATGAGGGGAAAGAGGCGGG + Intergenic
1098163123 12:67666699-67666721 ATGAATGAAGGGAAGAAGGGAGG + Intergenic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1098630174 12:72713341-72713363 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
1098774030 12:74588832-74588854 CTGAGGGAGGAGAATCAGGCAGG + Intergenic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1100868941 12:98890031-98890053 ATGAATGATCAGAAGAAGACAGG + Intronic
1101545686 12:105710284-105710306 ATGAAGTTGGAGAAGTAGGCAGG - Intergenic
1102487307 12:113266940-113266962 ATGAAGAAGGAGAAACAGGAAGG - Intronic
1102935505 12:116893152-116893174 TTGAAAGAGGAGAAGTGGGCTGG - Intergenic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1104349081 12:128029290-128029312 ACGAATGAGGAGCAGCAGAATGG - Intergenic
1104441138 12:128794271-128794293 AATAATGAGGAAAAGCAGGAGGG + Exonic
1104498418 12:129262456-129262478 ATGGATGAGGACAGGCAGCCAGG + Intronic
1104675174 12:130707535-130707557 ATGAAGGAGGAAGAGCTGGCAGG + Intronic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1104830462 12:131747451-131747473 ATGAGGTAGGAGAAGCAGGCAGG + Intronic
1105527235 13:21187302-21187324 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1105552451 13:21410566-21410588 ATGAATCAAGAGAGGCAGTCTGG + Intronic
1105786743 13:23757573-23757595 GTGAAGGAAGAGAAGCTGGCAGG + Intronic
1106338138 13:28803371-28803393 AAGGATGAGGAGAAGCTGGGCGG + Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1107243355 13:38264499-38264521 GAGAGTGAGGAGAAGCAGGGTGG + Intergenic
1107476035 13:40736196-40736218 ATGAATGAAATGAAGCAGGAAGG + Intronic
1107961424 13:45562806-45562828 AGGATTCAGGAGAGGCAGGCAGG + Intronic
1108362491 13:49679925-49679947 AGTAATAAGGAGAGGCAGGCTGG + Intronic
1112771008 13:102794956-102794978 ATTAAGGAGGAAAAGTAGGCTGG + Intronic
1114070631 14:19102880-19102902 ATGAATGAGGAGGAGCCTGCAGG + Intergenic
1114091630 14:19297126-19297148 ATGAATGAGGAGGAGCCTGCAGG - Intergenic
1114491159 14:23102889-23102911 ATGAATAGGGAGAAGCAAACAGG - Intergenic
1114892172 14:26939078-26939100 ATGAAGGAGGAGAAGATGACTGG - Intergenic
1115298874 14:31861565-31861587 AAGAAGGAGGAGAAGAGGGCAGG - Intergenic
1115469945 14:33758161-33758183 CTGGAGGAGGTGAAGCAGGCTGG - Intronic
1115616830 14:35103222-35103244 ATGAAGTTGGAGAAGTAGGCAGG - Intronic
1116255846 14:42554274-42554296 AGGAAGGAGGAGAAGAAGGAAGG + Intergenic
1116408978 14:44600912-44600934 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1116454502 14:45103660-45103682 ATGAAATAGAGGAAGCAGGCAGG + Intronic
1117024525 14:51606603-51606625 ATGAATGCTGAAAAGCAGGGAGG + Intronic
1117756150 14:58976124-58976146 AGGAGTGAGGAGAAGCTGGAGGG + Intergenic
1117846995 14:59921604-59921626 ATACATTAGGAGAAGGAGGCTGG + Intronic
1117932175 14:60855023-60855045 AGGAATGTAGAGAAGCAGTCTGG + Intronic
1118642824 14:67808151-67808173 ATAAATGAGGAGTTGGAGGCTGG + Intronic
1119254744 14:73185494-73185516 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1119409978 14:74424578-74424600 ATGGAAGAGGAGAAGAAGGGAGG + Intronic
1120505933 14:85353369-85353391 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1120864245 14:89282154-89282176 ATGATTGAGGAGGAGTAGGAGGG + Intronic
1121158182 14:91707131-91707153 ATGAGTTTGGAGAAGCTGGCAGG - Intronic
1121166888 14:91810380-91810402 ATGAAAGAAGAGAAGTAGGAAGG + Intronic
1121695375 14:95908105-95908127 ATTCCTGAGCAGAAGCAGGCAGG - Intergenic
1122322255 14:100862120-100862142 AAGGAAGAGGAGAAGAAGGCAGG - Intergenic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124721575 15:32115354-32115376 ATGTGGGAGGAGAAGCAGGCAGG + Intronic
1125459819 15:39895119-39895141 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1126811457 15:52409927-52409949 CTGAAAGAGGAGAAGAAGGAAGG + Intronic
1127012008 15:54641805-54641827 GAGAATGAGGAAAAGCAGACTGG + Intergenic
1127310046 15:57744531-57744553 ATGACTGAGAGGAAGCAGGCAGG - Intronic
1128129186 15:65214489-65214511 CTGAATGAGGAGACCCAGGCAGG - Intergenic
1128226614 15:66006176-66006198 AAGGAAGAGGAGAGGCAGGCTGG + Intronic
1128533909 15:68475588-68475610 AAGAATGAGGAGGAGCAGAAGGG - Intergenic
1129360622 15:75021703-75021725 AGGAAGTAGAAGAAGCAGGCTGG + Intergenic
1129602981 15:77011020-77011042 GTGAAGGAGGGGAAGCAGGCGGG + Intronic
1129660543 15:77550607-77550629 ATTAAAGAGGAGAGGCAGGAGGG + Intergenic
1131072489 15:89474957-89474979 ATGAATGAAGGCAGGCAGGCAGG - Intronic
1131072521 15:89475081-89475103 ATGAATGAAGGCAGGCAGGCAGG - Intronic
1131072525 15:89475105-89475127 ATGAATGAAGGCAGGCAGGCAGG - Intronic
1131351193 15:91701424-91701446 ATGAAGGAGGAGAGGAAGGAAGG + Intergenic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132471906 16:109261-109283 TTAAATGTGGACAAGCAGGCCGG - Intronic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1133367885 16:5225509-5225531 ATGAAGGAGGAGAAGGAGCCAGG + Intergenic
1134132378 16:11658504-11658526 ATGAATGAATGGATGCAGGCAGG - Intergenic
1134617551 16:15663174-15663196 AGGAATGAGGAGAAACAGCCAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1134880785 16:17743798-17743820 AAGGATGAGGAGAAGCAGACAGG + Intergenic
1135179439 16:20260097-20260119 AAGAATGATGAGAAGAAGGCCGG + Intergenic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1135688737 16:24519393-24519415 AGGAGTGAGCACAAGCAGGCAGG - Intergenic
1136030778 16:27501306-27501328 ATGGATCAGGAGAAGCAGGAAGG - Exonic
1136246183 16:28977576-28977598 ATGAGTGTGGAGAGGTAGGCAGG + Intronic
1137486417 16:48895177-48895199 ATGAATCTGGAGAGGCAGGCAGG + Intergenic
1137493331 16:48951203-48951225 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1137595644 16:49721723-49721745 ATGAAGGTGGTCAAGCAGGCTGG + Intronic
1138602198 16:58062776-58062798 ATGCATGAGGAGGCGCAGACAGG - Intergenic
1138913468 16:61431845-61431867 ATGAAAGTGGAGAAGAAGGCCGG - Intergenic
1139164120 16:64546017-64546039 GTGAATGAGACGAAGGAGGCAGG - Intergenic
1139346312 16:66306168-66306190 GTGAATGAGAAGAGGCAGGTTGG + Intergenic
1140326231 16:74005775-74005797 ATGGATTAGGAGCAGCAGCCAGG + Intergenic
1141138964 16:81484800-81484822 ATGAATGAGGACACCCGGGCAGG - Intronic
1141585609 16:85031583-85031605 ATGAAGCTGGAGAAACAGGCAGG - Intronic
1141697085 16:85625220-85625242 GTGTGTGCGGAGAAGCAGGCCGG - Intronic
1141872862 16:86800811-86800833 ATGAATGTGGGGCAGCAGACAGG - Intergenic
1142290982 16:89193444-89193466 GGGAATGAGGGGACGCAGGCTGG - Intronic
1142332175 16:89462176-89462198 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1142533456 17:598068-598090 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1143689503 17:8549795-8549817 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1143742417 17:8964450-8964472 ATGAATCAGGAGACTGAGGCTGG + Intronic
1143890031 17:10095943-10095965 AGGAATGAGGAGGAACAGGAAGG - Intronic
1144622807 17:16829244-16829266 GGGTGTGAGGAGAAGCAGGCTGG + Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1144835132 17:18152830-18152852 ATGAATGGTGAGAAGGAGCCAGG - Intronic
1144883624 17:18443472-18443494 GGGTGTGAGGAGAAGCAGGCTGG - Intergenic
1145148604 17:20500914-20500936 GGGTGTGAGGAGAAGCAGGCTGG + Intergenic
1145204415 17:20974913-20974935 AGGATGGAGGAGATGCAGGCAGG + Intergenic
1145901380 17:28492583-28492605 ATGAAGCTGGAGAAGTAGGCAGG + Intronic
1145920408 17:28605154-28605176 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1146570457 17:33948223-33948245 CAGAATGAGGTAAAGCAGGCTGG - Intronic
1146674501 17:34764047-34764069 ATGAATGAGTAAAAGCAGCAGGG + Intergenic
1146921865 17:36718547-36718569 ATGAAGCTGGAGAGGCAGGCAGG - Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1147577134 17:41609179-41609201 GGGTGTGAGGAGAAGCAGGCTGG + Intergenic
1147610202 17:41797531-41797553 ATGAATGAAGGGAGGCAGGGGGG - Intergenic
1147899551 17:43775056-43775078 ATGAGGCAGGAGAAGCTGGCAGG - Intronic
1148071958 17:44913867-44913889 AGGAATGGGGAGAAGGAGCCTGG - Intronic
1148141735 17:45333864-45333886 AGGAATCAGGAGCAGGAGGCGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148719587 17:49741545-49741567 CTTAAGGAGGAGAAGCAGGCAGG + Intronic
1148739771 17:49886191-49886213 AGGAATGGGGAGAGGCAGGGAGG + Intergenic
1149114907 17:53081551-53081573 ATGAAGCAGGAGAGGAAGGCAGG + Intergenic
1149180012 17:53924670-53924692 CTGAAAGAAGAGCAGCAGGCTGG - Intergenic
1149523432 17:57335847-57335869 ATGTGTGAGGAGTAGCAGGGAGG + Intronic
1151275651 17:73032095-73032117 ATGAGTGAGGCCAAGCATGCTGG + Intronic
1151323982 17:73367804-73367826 TTGAATGAGAAGAGGCCGGCAGG - Intronic
1151519224 17:74616497-74616519 TTGAATGAGGGGGAGCAGCCTGG + Intronic
1151529186 17:74693499-74693521 ATGAAAGAGGAAGACCAGGCAGG + Intronic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1151788396 17:76287909-76287931 GTGAATGAGGAGGGTCAGGCAGG + Intronic
1151842645 17:76628796-76628818 ATGGGGGAGGAGGAGCAGGCAGG - Intronic
1152128989 17:78465037-78465059 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1152998550 18:431589-431611 ATGCATGAGGAGGAGCACACTGG + Intronic
1153134107 18:1893983-1894005 ATGAATGAAAAGAAGCAGGGCGG - Intergenic
1153216663 18:2827201-2827223 ATGAGTGAGAACAAGCAGACAGG - Intergenic
1153633910 18:7097956-7097978 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1153836671 18:8969973-8969995 AGGAATGAGGAGAAGGAGGTTGG - Intergenic
1153939995 18:9969191-9969213 GAAGATGAGGAGAAGCAGGCGGG - Intergenic
1155416069 18:25601236-25601258 AGGAAAGAGTAGAAGCAGGAAGG - Intergenic
1156137905 18:34067303-34067325 ATGTTTGAGGAGCAGCAGGGAGG + Intronic
1156390977 18:36650445-36650467 ATGACTGAGAAGAAGCCAGCAGG + Intronic
1156509877 18:37627388-37627410 AAGAGTGAGGAAAAGCTGGCAGG + Intergenic
1156787678 18:40935176-40935198 AAGAATGAGGAAAAGAAGTCAGG + Intergenic
1156798481 18:41078241-41078263 ATGCAGGAGGAAAAGAAGGCAGG - Intergenic
1157406434 18:47425770-47425792 ATGAGAGAGGGGAAGCAGGGAGG - Intergenic
1157589686 18:48828914-48828936 AGGGAGGAGGAGGAGCAGGCGGG - Intronic
1158389163 18:57029874-57029896 ATGAATGATTAGAAGCAGCAGGG - Exonic
1158555513 18:58471519-58471541 ATGGAGGAGGAGCAGCAGGCTGG - Intergenic
1158969298 18:62651444-62651466 ATGAATGAGGAAATGCACTCAGG + Intergenic
1159340602 18:67127565-67127587 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1159744220 18:72211211-72211233 AGGCAAGAGGAGAAGCAGGAAGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160217299 18:76943341-76943363 AGGGGTGAGGAGGAGCAGGCCGG + Intronic
1161019073 19:1999368-1999390 TGGAAGGAGGAGAAACAGGCCGG + Intronic
1161980329 19:7626886-7626908 AGGGGTGGGGAGAAGCAGGCAGG - Intronic
1162000161 19:7739433-7739455 AAGAATGAAGAGGAGCAGGTAGG + Intergenic
1162318610 19:9957217-9957239 ATGAATGAGGACAAGTATTCAGG + Intergenic
1163121505 19:15221006-15221028 CTGAATGAGGTTAAGCAGGGAGG - Intergenic
1163623547 19:18374725-18374747 ATGGCTGGGGAGAAGCAGGCAGG + Intronic
1164434304 19:28215930-28215952 ATGAATGAGTAAAGGAAGGCAGG + Intergenic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1164726193 19:30467562-30467584 ATGAATGACGACAAGGAGGGTGG + Intronic
1166838006 19:45678971-45678993 CCGAATGAGGTGAAGCAGGTTGG - Intronic
1167038648 19:47009226-47009248 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1167577514 19:50324925-50324947 ATAAAAGAGGAGAGTCAGGCAGG + Intronic
1168240295 19:55085822-55085844 GTGACTGAGGAGAAGCGGGAGGG - Exonic
926215697 2:10903756-10903778 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
926354419 2:12027520-12027542 ATGAGTGAGAAGAAGAAGGGAGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
926989195 2:18658899-18658921 AAGGATGAGGAGAAGGAGGAGGG + Intergenic
927000288 2:18787904-18787926 ATGTATGAGGAGAATGAGTCAGG + Intergenic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
928665578 2:33547841-33547863 AGGAAGGAGGAGAAGCGGGGTGG + Intronic
929110514 2:38402792-38402814 CTGAGTTAGGAGAATCAGGCAGG - Intergenic
930405844 2:50954628-50954650 AAGAAAGAAGAGAAGCAGGCAGG + Intronic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
930880498 2:56264795-56264817 ATGAGTGAGGTGGAGCATGCTGG - Intronic
931090464 2:58880574-58880596 AGGAAAGAGGAGAAGGAGGCCGG + Intergenic
931576251 2:63721836-63721858 CTGAGTCAGGAGAATCAGGCAGG - Intronic
932253944 2:70267688-70267710 CTGAAGCAGGAGAATCAGGCAGG + Intronic
932501803 2:72188663-72188685 TTGTATGTGGAGAATCAGGCTGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932877040 2:75463619-75463641 ATGCATAAGGAGATGCAGGTTGG - Intergenic
933071084 2:77858422-77858444 AAGGTGGAGGAGAAGCAGGCAGG - Intergenic
933841603 2:86291225-86291247 ATGAATGAGGAGTAGGAGAGTGG + Intronic
934051411 2:88214401-88214423 AGGAGTGGGGAGAAACAGGCAGG + Intergenic
934548570 2:95240301-95240323 AAGAATGAAGAAAAGCAGGGTGG + Intronic
934623522 2:95831067-95831089 ATGACTGACTAGAAGCAGGTAGG + Intergenic
934850649 2:97698587-97698609 ATGCAAGTGGAGAAGTAGGCTGG + Intergenic
935416066 2:102820745-102820767 ATGAAGTTGGAGAAGCAGGAAGG + Intronic
935482124 2:103603368-103603390 ATTAATCCGGAGATGCAGGCTGG + Intergenic
937487085 2:122326458-122326480 ATGAAGGATGAGAAGAAGGCTGG - Intergenic
937802024 2:126091449-126091471 AGGAATTTGGAGAAGCAGGTTGG + Intergenic
938604524 2:132878461-132878483 ATGAATGAGAAGAACCATGTCGG - Intronic
938730533 2:134143590-134143612 ATGGATGAGGAACATCAGGCAGG + Intronic
939680659 2:145128065-145128087 ATGAATGAGAAAAACGAGGCGGG - Intergenic
939976346 2:148720775-148720797 GGGAATGAGGAAAAGCAGGGTGG - Intronic
940124873 2:150311723-150311745 AGGAATGCAGAGAAGCAGTCTGG - Intergenic
940285953 2:152033181-152033203 ATGAATGAGGAGAAGCGGGGTGG + Intronic
940635434 2:156292969-156292991 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
940659916 2:156533439-156533461 CTGAATGGTGAGACGCAGGCTGG - Intronic
940804263 2:158168324-158168346 AAGCAAGAGGTGAAGCAGGCTGG + Intergenic
941465190 2:165817242-165817264 AAGAAGGAGGAGAAGAAGGAAGG + Intergenic
942951497 2:181727535-181727557 ATGAAGGAAGTGAAGCAGTCAGG + Intergenic
943577909 2:189653047-189653069 TTGAAGCAGGAGAATCAGGCAGG - Intergenic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
944365010 2:198908123-198908145 ATAAGTGTGGAGAAGCAGGTGGG + Intergenic
944614315 2:201444328-201444350 ATGAGGGAGGAGAAGCAGGCAGG - Intronic
945077238 2:206052165-206052187 ATGAATGAGAAAAAGCAGTTTGG - Intronic
945220812 2:207482061-207482083 ATGACTGTGGAGAAGCAGGAAGG + Intergenic
946954017 2:224908791-224908813 TTGAAAGAACAGAAGCAGGCTGG - Intronic
947239768 2:227981757-227981779 ATGCATGAGGAGCAGAAGGATGG - Exonic
948087873 2:235266283-235266305 AGGAGTCAGGAGAAGCAGGTGGG + Intergenic
948623178 2:239249446-239249468 TTGAGTGGGGAGAAGCAAGCCGG + Intronic
1168841443 20:912487-912509 ATGGATGAGAAGCTGCAGGCAGG - Intronic
1169329917 20:4708279-4708301 ATGCATCAGCTGAAGCAGGCAGG - Intergenic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170810498 20:19670274-19670296 ATGCATGAGGAACAGCAGGTGGG + Intronic
1170836429 20:19888658-19888680 ATGAATGAGGAAAGACAGGGTGG + Intronic
1170842222 20:19933295-19933317 GTGCAGGAGGAGAGGCAGGCAGG - Intronic
1170976995 20:21174028-21174050 AAGAACGAGGAGAACCAGGAGGG + Intronic
1171032561 20:21690815-21690837 CTGATTGAGGAGAAGCTGACAGG + Intergenic
1171299814 20:24050380-24050402 GGCAATGAGGAGAAGCAGTCTGG + Intergenic
1171330400 20:24332415-24332437 ATAAATGAGGGGAAGGAGACAGG - Intergenic
1172013505 20:31860188-31860210 ATGAATGAGGAGTAGGAAGTTGG + Intronic
1172154291 20:32812855-32812877 AAGAAAGGGGAGAAGTAGGCAGG - Intergenic
1172614802 20:36275925-36275947 ATTAATCAGGAGACCCAGGCAGG - Intergenic
1172671161 20:36635317-36635339 ATTAAGTAGGAGAAGCAGCCAGG + Intronic
1172728732 20:37068945-37068967 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173623681 20:44455812-44455834 ATGAGTGAAGAGAAGAAGGGAGG + Intronic
1173835639 20:46123498-46123520 AAAACTGAGGAGAAGCAGGAGGG - Intronic
1173861629 20:46287622-46287644 ATGAGACAGGAGAAGCAGGCAGG + Intronic
1173990971 20:47303183-47303205 ATGGGTGAGGAGCAGCAGGAAGG + Intronic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174518066 20:51108630-51108652 ATGAGTGAGCAGATCCAGGCAGG - Intergenic
1175015647 20:55787140-55787162 AAGAATGAGGAGAGGCAAGTGGG + Intergenic
1175322185 20:58096980-58097002 ATGAATGAGGGGCAGAAGGCAGG - Intergenic
1175380095 20:58556970-58556992 ATGAATGACAAGAAGGAGCCAGG + Intergenic
1176522830 21:7837870-7837892 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1178202526 21:30423647-30423669 ATGATGGAGGAGAAGGAGGAGGG + Intronic
1178397104 21:32252338-32252360 ATGAATGAAGGCAGGCAGGCAGG + Intergenic
1178656850 21:34467882-34467904 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1178667821 21:34564343-34564365 ATGAAGCTGGAGAGGCAGGCAGG + Intronic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179622993 21:42631168-42631190 ATCAATAAGGAAAACCAGGCCGG - Intergenic
1179681685 21:43026167-43026189 ATGAATGCAGAAAAGCAGGAGGG - Intronic
1180489099 22:15825345-15825367 ATGAATGAGGAGAAGCCTGCAGG + Intergenic
1181265194 22:21627010-21627032 ATGAGTGGGTAGAAGCAGGAAGG + Intergenic
1181407190 22:22693349-22693371 ATGAAAGTGGAGGAGCAGCCAGG - Intergenic
1181450962 22:23020394-23020416 ATGCATCAGGAGTAGGAGGCAGG + Intergenic
1181626399 22:24125108-24125130 AGGTATGAGGAGTAGCAGCCTGG + Intronic
1181759881 22:25050995-25051017 GTGAAAGAGGAGGAGCAGGACGG - Intronic
1182029533 22:27147005-27147027 AGGAAGGAGGAGATACAGGCTGG - Intergenic
1182101895 22:27663265-27663287 AGGAATGAGGAGCGGCAGGAAGG - Intergenic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182987565 22:34734874-34734896 ATCACTGAGGAGAAGCTTGCTGG - Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183415159 22:37677424-37677446 ATGAATGACCAGACGCAGGAAGG - Intronic
1183486093 22:38088583-38088605 ATGAATGAGGAAACTGAGGCAGG + Intronic
1184550110 22:45199968-45199990 AGGGATGGGGAGAAGAAGGCAGG + Exonic
1184676180 22:46044706-46044728 AAGAAGGAGGAAAAGCAGGCCGG - Intergenic
1184922129 22:47613222-47613244 GTGAATGAGGAGAAGAGTGCAGG - Intergenic
1203301927 22_KI270736v1_random:83085-83107 TGGAATGGGGAGAAGCAGACAGG + Intergenic
949117997 3:351824-351846 ATGTATGAGCAAAAGCAGCCAGG + Intronic
949570142 3:5284623-5284645 ATGAGGCAGGAGAATCAGGCAGG + Intergenic
949701258 3:6761807-6761829 ATGAATGTGGAGAAGCAGGCAGG + Intergenic
950528786 3:13540488-13540510 TTGGCTGAGGAGAAGCAGACAGG + Intergenic
950675241 3:14550601-14550623 ATGCATGAGGAGATTGAGGCCGG - Intergenic
950931178 3:16790473-16790495 AAGAATTTGGGGAAGCAGGCTGG - Intergenic
951001330 3:17563438-17563460 ATGAATCAGGAAAATCAGGAAGG + Intronic
951437928 3:22686693-22686715 ATGAATTTTGAGAGGCAGGCAGG - Intergenic
951596635 3:24325747-24325769 ATCAATGAAGAAAAACAGGCAGG - Intronic
951875207 3:27417246-27417268 ATGAACAGGGAGAACCAGGCAGG + Intronic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
953316877 3:41936169-41936191 ATGAATGGTGAGAAGCAAGCAGG + Intronic
954060243 3:48061289-48061311 CTGAGGGAGGAGAATCAGGCAGG - Intronic
954407172 3:50351678-50351700 ATGAGTGAGGTGGAGCAGGTAGG + Intronic
954481496 3:50804638-50804660 CTGAAGCAGGAGAATCAGGCAGG + Intronic
955075741 3:55611438-55611460 GTCAGTCAGGAGAAGCAGGCTGG + Intronic
955674710 3:61435617-61435639 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
955683045 3:61522362-61522384 ATTAATGTGGAGAGACAGGCAGG + Intergenic
956459648 3:69458599-69458621 ATGAAAGAGGAGAATTTGGCTGG - Intronic
956898510 3:73688470-73688492 ATGAATGAGGGAAGGAAGGCAGG - Intergenic
959022667 3:101205549-101205571 TTGAATGTGGAGAAGCAGACTGG + Intergenic
960083486 3:113566222-113566244 ATGAATGAGGAGAAACAACTGGG + Intronic
960183771 3:114613986-114614008 AAGGATGAGGAGAAGGAGGTGGG - Intronic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960682644 3:120265073-120265095 ATGACTTAGGAGAAGCAGGAGGG + Intronic
960697916 3:120413888-120413910 CTGAGTCAGGAGAATCAGGCAGG - Intronic
960997773 3:123351082-123351104 GTGAATGGGGAGAGCCAGGCTGG + Intronic
961371336 3:126433777-126433799 AGGAGAGAGGAGCAGCAGGCAGG - Intronic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
962392059 3:134980821-134980843 ATGACTTACGAGCAGCAGGCAGG - Intronic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962984497 3:140522173-140522195 GGGAATGAAGAAAAGCAGGCTGG - Intronic
963591149 3:147261310-147261332 ATGAAAGAGGAGGAGGAGACTGG - Intergenic
964230997 3:154467863-154467885 CTAAATGATGAGAAGCAGCCAGG - Intergenic
964295254 3:155225880-155225902 AAGAGTGAGGAAAAGCAGGGTGG - Intergenic
964501636 3:157354526-157354548 ATGAATAAGGAGAAGCAGCAAGG - Intronic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
964774512 3:160261151-160261173 AGGAATGAGAAGAAGAAGGATGG - Intronic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
964953115 3:162322069-162322091 ATGAAAGAGGAGAGGGAGACAGG + Intergenic
965764430 3:172115158-172115180 AAGAATGAGGAGACACAGGATGG - Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
968161612 3:196431965-196431987 ATGAAGGAGGAGGAGGAGGGCGG + Intronic
968332702 3:197885179-197885201 ATGTCTGAGGAGCAGCAGGAGGG - Intronic
968524266 4:1048028-1048050 ATGATTTAGGTGAAGAAGGCTGG + Intergenic
969216434 4:5726311-5726333 GTGAATGAAGATAAGCAGACAGG - Intronic
969235930 4:5865065-5865087 ATGGAGGAGGAGGAGGAGGCTGG - Intronic
969275497 4:6132902-6132924 ATGAATGTGTAGAAGTTGGCTGG - Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969649466 4:8455658-8455680 TTAAATGAGCAGAAGCAGCCAGG - Intronic
969888646 4:10239388-10239410 TTGAAAGAGGAAAAGCGGGCTGG + Intergenic
970185340 4:13446078-13446100 AGGAATTAAGAGAAGCAGTCTGG + Intronic
970492069 4:16584804-16584826 AGGAGTGGGGAGAAGCAGGAAGG + Intronic
970511818 4:16788696-16788718 ATGAATGAAGACAAGAAGGAAGG + Intronic
970537750 4:17046612-17046634 ATGAATCATGAGAAGAAGGGTGG + Intergenic
970943997 4:21668997-21669019 GAGGAGGAGGAGAAGCAGGCAGG - Intronic
971617771 4:28814397-28814419 ATGAATATCTAGAAGCAGGCTGG + Intergenic
971790137 4:31159593-31159615 AAGAAAGAAGAGAAGAAGGCAGG + Intergenic
972614018 4:40680887-40680909 ATGGATGAGTGGAAGAAGGCTGG + Intergenic
974305582 4:60134549-60134571 ATGAAGCATCAGAAGCAGGCTGG - Intergenic
974471114 4:62319159-62319181 ATGAATGAAGAGCAGAAGACAGG - Intergenic
975097844 4:70477856-70477878 ATGAATGTGAACAGGCAGGCAGG + Intronic
975322538 4:73024823-73024845 ATGATGGAGGAGAAGCATACTGG + Intergenic
975611049 4:76203707-76203729 ATGAAGGAACAGATGCAGGCTGG + Intronic
975767825 4:77687602-77687624 AAGAATGAGGAGAGGAAGGAAGG + Intergenic
976149277 4:82077214-82077236 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
976943764 4:90739129-90739151 AATAATGAGCAGTAGCAGGCAGG - Intronic
977129128 4:93211912-93211934 ATGAATGAGAATAAGTATGCGGG - Intronic
977204969 4:94157381-94157403 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
978855304 4:113387584-113387606 TTGAACGGGGAAAAGCAGGCTGG + Intergenic
979732910 4:124045813-124045835 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
980715183 4:136618160-136618182 ATGAATCGGGAGACACAGGCCGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981273755 4:142874520-142874542 AAGAGTGAGGAGAAACAGGGTGG + Intergenic
983037337 4:162883686-162883708 ATGAATGAGGAGAATAGTGCTGG + Intergenic
983059587 4:163142868-163142890 CTGTATGAGGAGAAGTGGGCCGG - Intronic
983518066 4:168677947-168677969 AGGAGAGAGGAGCAGCAGGCTGG - Intronic
984642057 4:182177454-182177476 GTGAATCAGGAGCATCAGGCTGG - Intronic
985951576 5:3225511-3225533 CTGTGGGAGGAGAAGCAGGCTGG - Intergenic
986418056 5:7547962-7547984 ATAAAGGAGGAGCAGCATGCTGG - Intronic
986500771 5:8397047-8397069 ATGACTGAGGACAGGCAGGGTGG - Intergenic
986875326 5:12100518-12100540 ATGAAGGACGAGAGGAAGGCAGG + Intergenic
986881847 5:12183925-12183947 GGGAATGAAGAGAAGCAGGCAGG + Intergenic
987147466 5:15006193-15006215 ATGAGTGTGGAGAAGTAGGCAGG - Intergenic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987260094 5:16194891-16194913 AAGAATGAAGAAAAGCAGGGTGG + Intergenic
987268154 5:16277748-16277770 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
988021471 5:25627360-25627382 AGGAATCTAGAGAAGCAGGCTGG - Intergenic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988920196 5:35934417-35934439 ATGGATCAGGAGAAGCACACAGG - Intronic
989143472 5:38225051-38225073 ATGAAAGAGGAGAAGGAGAAAGG + Intergenic
989242899 5:39220602-39220624 ATGAATGAGTAGAAGGAAGGTGG - Intronic
990516334 5:56534297-56534319 ATTAATGAGCCGAGGCAGGCAGG - Intronic
992384214 5:76268110-76268132 ATGAGTGTGGAGAAGCAGGCTGG + Intronic
992641409 5:78771290-78771312 ATTAAAGGGGAAAAGCAGGCTGG + Intergenic
993536783 5:89096145-89096167 AGGAGTGGGGAGAGGCAGGCAGG - Intergenic
993712877 5:91245266-91245288 GTGAATGAGGACAGCCAGGCTGG + Intergenic
993866790 5:93205423-93205445 ATGAATGGGGAGAGGAAAGCTGG + Intergenic
994371573 5:98973314-98973336 AAGAATGAGGAGAAGGAAGAAGG + Intergenic
994538367 5:101060487-101060509 ATGAATGAAATGAAGCAGGAAGG - Intergenic
994793717 5:104265884-104265906 AAGAAGGAGGAAAAGCAGGAAGG + Intergenic
995156532 5:108920891-108920913 AATAATGAGGGGAAGTAGGCAGG - Intronic
995518307 5:112976083-112976105 ATGAATAAGGACGAGCAGGTGGG + Intergenic
997348558 5:133212086-133212108 GTGAATGAAGAGAAACTGGCAGG - Intronic
998345967 5:141463740-141463762 ATAAGAGAAGAGAAGCAGGCCGG - Intronic
998880299 5:146638437-146638459 AGGAACCAGGAGAAGGAGGCAGG + Intronic
999323202 5:150627173-150627195 GGGACTGAGGGGAAGCAGGCAGG + Intronic
999897641 5:156052346-156052368 ATGAAAGGGGAGAGGCTGGCAGG + Intronic
1000150135 5:158492174-158492196 GTGAGGGAGAAGAAGCAGGCAGG - Intergenic
1000269057 5:159665744-159665766 ATGAATGAGGACATGCAACCTGG - Intergenic
1000313270 5:160064876-160064898 AGGAATGAACAGAAGCAGGAAGG - Intronic
1000660537 5:163933221-163933243 AGGAATCAAGAGAAGCAGTCTGG - Intergenic
1001249111 5:170132518-170132540 ATGAAGGAGAAGAAGCTGGTAGG + Intergenic
1001630963 5:173175197-173175219 CTGCATTAAGAGAAGCAGGCTGG - Intergenic
1002157915 5:177297245-177297267 ATGAAAGGGGAGAACTAGGCAGG - Exonic
1002764103 6:225029-225051 AGGCATGAGGAGAAGCCTGCAGG + Intergenic
1004420614 6:15466235-15466257 AGGAAACAGGAGAAGCAGGAGGG - Intronic
1005282064 6:24284731-24284753 ATGAAATCGGAGAGGCAGGCAGG - Intronic
1006299594 6:33186492-33186514 ATGAATGAGGACTAGGAGGAGGG + Intronic
1006833658 6:36984384-36984406 AGGAATGAGGAGATTCAGTCAGG - Intronic
1007972288 6:46064726-46064748 ATGAAGGAAGAGAAGAAGGGAGG + Intronic
1007983163 6:46179891-46179913 AAGAGTGAGGACAAGGAGGCAGG + Intergenic
1008377756 6:50810668-50810690 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1008786662 6:55175851-55175873 ATGAATGAAGAGTAGAAGGCTGG + Intronic
1010091721 6:71990666-71990688 AAAAGTGAGGAGAAGCAGTCTGG + Intronic
1010457688 6:76077243-76077265 ATGAATGTGGATAAGGATGCAGG - Intergenic
1010512999 6:76743761-76743783 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1010526647 6:76907808-76907830 ATGAAGGAGGAAAAGAATGCTGG - Intergenic
1010938885 6:81892431-81892453 AGGATTGAAGAGAAGCAGGCAGG - Intergenic
1011231608 6:85167959-85167981 ATGAGTGAGGAGATGAAGGGAGG - Intergenic
1011553173 6:88548311-88548333 AAGAGTGAGGGGAAGAAGGCAGG + Intergenic
1011822915 6:91273805-91273827 ATGAATTAGGCGAAGGAGCCAGG + Intergenic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012142543 6:95642329-95642351 ATGAATGAAGAAAAGCATGGTGG + Intergenic
1012393107 6:98766012-98766034 ATGAAAGAGAAGATACAGGCTGG + Intergenic
1012407732 6:98919525-98919547 ATGAGGAAAGAGAAGCAGGCTGG + Intronic
1012512198 6:100014816-100014838 ATTAAAGGGGAAAAGCAGGCTGG + Intergenic
1013700906 6:112768245-112768267 TGGACTGAGGAGAAGCAGACAGG - Intergenic
1013989138 6:116233337-116233359 ATGAATGAAGAAAAGAAGGAGGG - Intronic
1015156533 6:130102593-130102615 ATGAACCGGGAGAAGCAGGCAGG - Intronic
1015333223 6:132005589-132005611 AAGAAGGTGGAGGAGCAGGCAGG + Intergenic
1015677832 6:135770214-135770236 ATGAATGAAGTGAAGCAAGAAGG - Intergenic
1016769762 6:147835903-147835925 AGGAATGAGGGGCAGAAGGCAGG - Intergenic
1016883348 6:148933516-148933538 TTGAATAATGAGAAGCACGCAGG + Intronic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017677951 6:156834136-156834158 ATGAATGGGGAGAGGAAGACTGG + Intronic
1017754482 6:157518008-157518030 ATGGATGTGGACACGCAGGCTGG + Intronic
1018475638 6:164138162-164138184 AGGAATGCAGAGAAGCAGGTGGG - Intergenic
1018528288 6:164736903-164736925 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1018658881 6:166066967-166066989 TAGAATGAGAAGAAGCAGGTAGG - Intergenic
1018776999 6:167026712-167026734 CTGAATGAGCAGCAGCAGGAAGG - Intronic
1019540090 7:1547472-1547494 GTGACTGATGAGAAGCCGGCAGG + Intronic
1020415583 7:7942094-7942116 ATGAATGATGAAAAGGAGTCAGG - Intronic
1020466597 7:8486649-8486671 ATGAGTTTGGAGAGGCAGGCAGG - Intronic
1021229505 7:18068849-18068871 ATGAGTTAAGAGAAGTAGGCAGG - Intergenic
1021256035 7:18393529-18393551 ATGGATGAGGTGAGGCAGGGAGG + Intronic
1021627717 7:22610743-22610765 ATGATTGAAGAGAAGAAGGGAGG + Intronic
1021628748 7:22622909-22622931 GTGGATGAGGTGAAGCAAGCAGG - Intronic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1022109003 7:27216499-27216521 AAGAATGAGGGGATGCAGGAGGG + Intergenic
1022286769 7:28961085-28961107 AAGAATCTGGAGATGCAGGCTGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1024033375 7:45484112-45484134 AGGAAAGAGGAAAAGGAGGCAGG + Intergenic
1024475198 7:49801907-49801929 GTGAAGGAGGAGAAACAGGGTGG - Intronic
1025764948 7:64435333-64435355 AGGAGTGAGGGGAAGCAGGTAGG - Intergenic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1026452012 7:70537763-70537785 ATGAAGGAGGAAATGAAGGCAGG + Intronic
1026454590 7:70559628-70559650 AAGAAAGAGTAGAAGCTGGCTGG - Intronic
1027676126 7:81160983-81161005 AAGAATGAGGAGAGCCAGCCGGG + Intergenic
1028931371 7:96416122-96416144 ATGAATGGTGATAAGCAGGTTGG + Intergenic
1029292344 7:99511774-99511796 ATGGATGAGAAGAAGCCAGCCGG - Intronic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1030676953 7:112394201-112394223 AAGAAAGAAGGGAAGCAGGCAGG - Intergenic
1030682501 7:112448888-112448910 ATGAATGAGGAAATGGAGGTAGG + Intronic
1030692548 7:112551115-112551137 AGGAGTGAGGAGAATCAGGCAGG - Intergenic
1030794887 7:113775798-113775820 ATGAATTTGCAGAAGCAGGTAGG - Intergenic
1032253765 7:130280780-130280802 AAGAGCTAGGAGAAGCAGGCTGG - Intronic
1032729986 7:134631280-134631302 ATGCATGAGGTGAGTCAGGCTGG + Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033778512 7:144641572-144641594 ATGAATGAGGAGAGGCAGGCAGG + Intronic
1033868329 7:145718938-145718960 GAGAGTGAGGAGAAGCAGGGTGG - Intergenic
1034083170 7:148299314-148299336 AAGAATGAGTAGAAGTAGCCAGG + Intronic
1034256220 7:149725973-149725995 CTGGATGAGGAGAAGCTGGTGGG - Exonic
1034369118 7:150579202-150579224 ATGAATGAAATGAAGCAGGAAGG - Intergenic
1034634198 7:152554271-152554293 ATGAAGGAAGAGAGGTAGGCAGG + Intergenic
1035029635 7:155848820-155848842 ATGAAAGTGGAGACCCAGGCTGG - Intergenic
1035717590 8:1765278-1765300 CTGAGAGAAGAGAAGCAGGCCGG + Intronic
1035815683 8:2537626-2537648 AGAAATGATGAGAAGTAGGCCGG - Intergenic
1036089564 8:5650741-5650763 ATGGAAGGGAAGAAGCAGGCAGG - Intergenic
1036126605 8:6068653-6068675 AGGAATGAGGAGGAGAAGGAAGG - Intergenic
1036709776 8:11070860-11070882 AGGAATGAGGGGCAGCGGGCAGG - Intronic
1038043706 8:23748555-23748577 ATGAATGAGGAGGTCCAGGATGG - Intergenic
1038438321 8:27554128-27554150 ATGAATGAAGTGAAGCAAGAAGG - Intergenic
1039383258 8:37106007-37106029 ATATATGAGGAGGAGCAGCCGGG - Intergenic
1039431843 8:37530938-37530960 ATGTCTGCGGAGCAGCAGGCAGG - Intergenic
1040894878 8:52355426-52355448 CAGAATGAGGACAAACAGGCTGG + Intronic
1041103398 8:54418666-54418688 TTGAATGATAAGAAGCTGGCAGG - Intergenic
1041951149 8:63504267-63504289 ATGAATGAGAAGAAAAATGCTGG - Intergenic
1042190757 8:66184572-66184594 ATGAAAAATGAGAATCAGGCTGG - Intergenic
1043550285 8:81363809-81363831 GTGAAAGATGGGAAGCAGGCAGG + Intergenic
1044460987 8:92443684-92443706 ATGAAGAAGGAGGAGCAGGTTGG + Intergenic
1045258294 8:100548260-100548282 ATGAATTTGGAGAGGTAGGCAGG - Intronic
1046499323 8:115055229-115055251 AAGAATGATTAGGAGCAGGCTGG - Intergenic
1046739457 8:117812839-117812861 ATGCCTGAGGAGCAGCAGGTGGG - Intronic
1046775104 8:118155826-118155848 TTGAATAAGGTGAAGCAGCCTGG + Intergenic
1047234928 8:123032428-123032450 ATGTATGAGGAAATGCAGCCAGG - Intronic
1047728867 8:127709199-127709221 AAGAATGAGGCCAAGGAGGCCGG - Intergenic
1048214783 8:132484131-132484153 ATGGAGGAGGGGAAGCAGGTGGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048489751 8:134881668-134881690 ATGCATGAAGAAAAGCAGCCGGG + Intergenic
1049704686 8:144035826-144035848 ATGACTGGGGAGAGGCAGTCAGG - Intronic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1050705813 9:8395728-8395750 ATTAATGAGGAGTTGCAGGTTGG - Intronic
1050856573 9:10364526-10364548 ATGCATAAAGAGAAGCAGCCTGG - Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051276706 9:15405933-15405955 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1051750083 9:20332067-20332089 AAGCATGAGGGGAAGCAGGGTGG - Intergenic
1053467854 9:38324132-38324154 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1053720612 9:40943272-40943294 AAGAAAGAGCAAAAGCAGGCCGG + Intergenic
1054856273 9:69902801-69902823 ATGAAATAGGAGAACAAGGCAGG - Intronic
1055252896 9:74329829-74329851 ATGAATGTGAGGAAGCAAGCAGG + Intergenic
1055956001 9:81773971-81773993 ATACAAGAGGAGAAGCAGGTTGG - Intergenic
1056802995 9:89707057-89707079 CCGAAAGAGGAGAAGCAGGAGGG - Intergenic
1056810760 9:89762188-89762210 ATATATTAGAAGAAGCAGGCTGG + Intergenic
1057716329 9:97498792-97498814 CTGAAGCAGGAGAATCAGGCAGG + Intergenic
1057917990 9:99072218-99072240 AAGTATGAGGAAAGGCAGGCAGG - Intergenic
1059082366 9:111264159-111264181 ATGACTTAGGAAAAGAAGGCTGG - Intergenic
1059492619 9:114681792-114681814 ATGAATGAGGTCAAACAGGAAGG + Intergenic
1060108244 9:120888275-120888297 ATGAGTGTGAAGAAGGAGGCTGG - Intronic
1061475343 9:130861913-130861935 AGGAAGGAGAAGGAGCAGGCTGG - Intronic
1203454518 Un_GL000219v1:152611-152633 AAGAAAGAGCAAAAGCAGGCCGG - Intergenic
1203386549 Un_KI270438v1:60745-60767 ATGAATGCGGAGAAGCGGAGTGG + Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1187180693 X:16940836-16940858 ATGAGTGAGGGACAGCAGGCTGG - Intergenic
1187307890 X:18113715-18113737 ATGGTGGAGGAGAAACAGGCAGG - Intergenic
1187529713 X:20085252-20085274 AGGAAAGAGGAGAAGAAGGATGG + Intronic
1188375374 X:29421996-29422018 GTGCATGAGGAGAACCAGGGTGG + Intronic
1190879731 X:54483729-54483751 AGGCAGGAGGAGAAGCAGACCGG - Intronic
1190960288 X:55240486-55240508 AAGAGTGAGGAAAAGCAGGGTGG + Intronic
1191184765 X:57597828-57597850 ATGCCTGAGGAGAAGCAGAAAGG - Intergenic
1192145306 X:68678206-68678228 ATCAATCAGGAGAAACAGTCAGG + Intronic
1192251994 X:69421491-69421513 CTGAAGCAGGAGAATCAGGCAGG - Intergenic
1192586007 X:72318668-72318690 ATGAGTGTAGAGAAGCAGGAAGG - Intergenic
1192703149 X:73497745-73497767 AGGAATCAGGAGAGGCAGTCTGG + Intergenic
1192743503 X:73915727-73915749 ATGATTCAGGTGAAGCAGGGAGG + Intergenic
1192794304 X:74413252-74413274 CTGAGTTAGGAGAATCAGGCAGG + Intergenic
1193164432 X:78264621-78264643 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
1193244249 X:79210416-79210438 ATGAATGAGATGAAGCAAGAAGG - Intergenic
1193741741 X:85225581-85225603 AAGAATGAGTAGAAGCATTCTGG + Intergenic
1194203441 X:90983151-90983173 AAGAGTGAGCAAAAGCAGGCTGG + Intergenic
1194673540 X:96765764-96765786 ATGAAACTAGAGAAGCAGGCAGG - Intronic
1195405724 X:104511087-104511109 TTGAATGATGAGAAGGAGACAGG - Intergenic
1195793829 X:108621622-108621644 ATGAATAAGGAGACTCAGTCTGG - Intronic
1195946878 X:110223952-110223974 ATAAATGAGGAAATGAAGGCTGG - Intronic
1196345624 X:114653645-114653667 ATGAACAAGGAGAAACAGGAGGG - Intronic
1196599821 X:117589426-117589448 GAGAATGAGGAAAAGCAGGGTGG + Intergenic
1197980562 X:132214797-132214819 AGGAGTGATGACAAGCAGGCAGG - Intronic
1198041740 X:132859695-132859717 AAGAATGAAGAAAAGAAGGCAGG + Intronic
1199267786 X:145848529-145848551 AGGAATGAGGACAAGCACACTGG - Intergenic
1199573321 X:149289668-149289690 AAGAGTGAGATGAAGCAGGCTGG - Intergenic
1199586284 X:149420235-149420257 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1199827256 X:151512800-151512822 TTTAATGGGGAAAAGCAGGCTGG + Intergenic
1200230198 X:154440136-154440158 ATGAGTGAGGGGAAGCTGGGTGG + Exonic
1200406479 Y:2817036-2817058 ATGAATGAGCAAAAGCTGGAAGG - Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200984765 Y:9293195-9293217 CTGTAGGATGAGAAGCAGGCAGG - Intergenic
1201382258 Y:13394778-13394800 ATGAGTGAGGAGAAGCAAGGAGG - Intronic
1202125676 Y:21566992-21567014 CTGTAGGATGAGAAGCAGGCAGG + Intergenic
1202153332 Y:21862400-21862422 CTGTAGGATGAGAAGCAGGCAGG - Intergenic