ID: 916492760

View in Genome Browser
Species Human (GRCh38)
Location 1:165316299-165316321
Sequence CTTACCACGGGGAGATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 125}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916492746_916492760 10 Left 916492746 1:165316266-165316288 CCCCTTCCCAGCCCCATGAACAC 0: 1
1: 0
2: 4
3: 45
4: 429
Right 916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 125
916492751_916492760 -1 Left 916492751 1:165316277-165316299 CCCCATGAACACATGCTGAGAGC 0: 1
1: 0
2: 1
3: 14
4: 179
Right 916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 125
916492752_916492760 -2 Left 916492752 1:165316278-165316300 CCCATGAACACATGCTGAGAGCT 0: 1
1: 0
2: 1
3: 17
4: 164
Right 916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 125
916492753_916492760 -3 Left 916492753 1:165316279-165316301 CCATGAACACATGCTGAGAGCTT 0: 1
1: 0
2: 1
3: 15
4: 193
Right 916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 125
916492750_916492760 3 Left 916492750 1:165316273-165316295 CCAGCCCCATGAACACATGCTGA 0: 1
1: 0
2: 1
3: 15
4: 183
Right 916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 125
916492749_916492760 4 Left 916492749 1:165316272-165316294 CCCAGCCCCATGAACACATGCTG 0: 1
1: 0
2: 1
3: 20
4: 179
Right 916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 125
916492747_916492760 9 Left 916492747 1:165316267-165316289 CCCTTCCCAGCCCCATGAACACA 0: 1
1: 1
2: 6
3: 43
4: 437
Right 916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 125
916492748_916492760 8 Left 916492748 1:165316268-165316290 CCTTCCCAGCCCCATGAACACAT 0: 1
1: 0
2: 2
3: 27
4: 348
Right 916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916492760 Original CRISPR CTTACCACGGGGAGATGGGG AGG Intronic
901383288 1:8889483-8889505 CTTCCTACGGGGACTTGGGGAGG - Intergenic
902048535 1:13543690-13543712 CTTCCCGGGGGGAGCTGGGGAGG - Intergenic
902331594 1:15733663-15733685 GTTCCCAGGGAGAGATGGGGAGG + Intronic
903657190 1:24956662-24956684 CTTACCCCACGGAGGTGGGGTGG + Intronic
913045329 1:115069119-115069141 CTTAGGAAAGGGAGATGGGGTGG + Intronic
914415694 1:147479491-147479513 CTTACAAGAGGGAGATGGGTGGG - Intergenic
915571585 1:156747870-156747892 CTTTCCATGGGAAGCTGGGGTGG - Intronic
916492760 1:165316299-165316321 CTTACCACGGGGAGATGGGGAGG + Intronic
924141581 1:241029208-241029230 ATTACCATGGGGGGAGGGGGAGG + Intronic
1070972489 10:80578996-80579018 CCCACCATGGGGAGCTGGGGAGG + Intronic
1071186982 10:83057759-83057781 GTTAGCAAAGGGAGATGGGGTGG - Intergenic
1073510807 10:104041268-104041290 CTTACCACTGGGAGGTGGGAGGG - Intronic
1077351990 11:2097295-2097317 CTTCCCGAGGGGAGATCGGGGGG - Intergenic
1078542621 11:12223908-12223930 CTCAACACAGGGAGATGGGATGG + Intronic
1078851485 11:15168050-15168072 CTTAACATAGGCAGATGGGGAGG - Intronic
1082166163 11:48954121-48954143 GTTACACAGGGGAGATGGGGAGG - Intergenic
1082241659 11:49878859-49878881 GTTACACAGGGGAGATGGGGAGG - Intergenic
1083272267 11:61578523-61578545 CCAGCCAAGGGGAGATGGGGAGG + Intronic
1083305963 11:61762187-61762209 CTGACCACGGAGAGGAGGGGAGG + Intronic
1089735011 11:120544711-120544733 GTTACCACGGGGACATGGAAAGG + Intronic
1090075924 11:123579975-123579997 CTTTCCCCTGGGAGATTGGGTGG + Intronic
1091498812 12:995335-995357 CTGACCAAGGTGAAATGGGGAGG + Intronic
1091712752 12:2753285-2753307 CTCACCACGGGGAGAGGCCGCGG + Intergenic
1096749898 12:53751981-53752003 ACAACCACGGGGAGAGGGGGAGG - Intergenic
1099470256 12:83039555-83039577 ATTCCCACAGTGAGATGGGGAGG + Intronic
1101352579 12:103945769-103945791 CTTTTAACGGGGAGGTGGGGTGG - Intronic
1102262023 12:111448674-111448696 CTTTCTACGGGGAGGAGGGGGGG + Exonic
1102563400 12:113778881-113778903 CGTCCCAGGAGGAGATGGGGAGG - Intergenic
1103010015 12:117450878-117450900 CTTACCACGTTCAGATGGGGTGG - Intronic
1107398003 13:40038476-40038498 CTTACCACATGGCGATGGGGTGG - Intergenic
1111810001 13:93088415-93088437 AATACCACGGGGGGGTGGGGGGG - Intergenic
1114269759 14:21093424-21093446 CTCACCTCGGGAAGATGGGGTGG + Intronic
1117177136 14:53156267-53156289 CTGACCAGAGGGAGATGGGTTGG + Intergenic
1118745478 14:68770128-68770150 CTTATCACGGGTTGATGGTGGGG + Intergenic
1119633715 14:76256928-76256950 GTTCCCATTGGGAGATGGGGAGG - Intergenic
1122374357 14:101248392-101248414 CTGGCCCCGGGGAGAAGGGGAGG - Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1131176671 15:90213578-90213600 CTTACGCCTGGGAGAAGGGGTGG - Intronic
1131436724 15:92428666-92428688 ATTTCCAAGGGGAAATGGGGAGG + Intronic
1139106653 16:63834880-63834902 CTTGCCGTGAGGAGATGGGGAGG + Intergenic
1141166764 16:81666071-81666093 CTCCCCACTGGGGGATGGGGCGG + Intronic
1141496918 16:84416756-84416778 CTGAACACGGGGAGAGGCGGGGG - Intronic
1141863799 16:86736011-86736033 CTTTCCAAGGGGAGAAAGGGAGG - Intergenic
1142222639 16:88863196-88863218 CGTCCCACGGGGAGACGCGGAGG + Intergenic
1142222651 16:88863232-88863254 CGTCCCACGGGGAGACGCGGAGG + Intergenic
1142756682 17:2020544-2020566 GTTTCCACGGGCAGATGGGCTGG - Intronic
1142808517 17:2384498-2384520 CTTACCTCGGGGAGAGGGGGAGG - Exonic
1146843379 17:36169317-36169339 TTTACCCTGGGGAGGTGGGGCGG + Intronic
1146855689 17:36257256-36257278 TTTACCCTGGGGAGGTGGGGCGG + Intronic
1146864932 17:36331119-36331141 TTTACCCTGGGGAGGTGGGGCGG - Intronic
1146871595 17:36381167-36381189 TTTACCCTGGGGAGGTGGGGCGG + Intronic
1146878955 17:36432249-36432271 TTTACCCTGGGGAGGTGGGGCGG + Intronic
1146882895 17:36453395-36453417 TTTACCCTGGGGAGGTGGGGCGG + Intergenic
1146923528 17:36729188-36729210 CTGTCCACGTGGAGATGTGGAGG + Intergenic
1147067791 17:37931713-37931735 TTTACCCTGGGGAGGTGGGGCGG - Intronic
1147074481 17:37981791-37981813 TTTACCCTGGGGAGGTGGGGCGG + Intronic
1147079322 17:38011268-38011290 TTTACCCTGGGGAGGTGGGGCGG - Intronic
1147086004 17:38061330-38061352 TTTACCCTGGGGAGGTGGGGCGG + Intronic
1147095262 17:38135210-38135232 TTTACCCTGGGGAGGTGGGGCGG - Intergenic
1147101949 17:38185295-38185317 TTTACCCTGGGGAGGTGGGGCGG + Intergenic
1149846541 17:60011805-60011827 TTTACCCTGGGGAGGTGGGGCGG + Intergenic
1150084887 17:62268380-62268402 TTTACCCTGGGGAGGTGGGGCGG + Intergenic
1150958378 17:69887696-69887718 CTTACCTCGGCCAGGTGGGGTGG + Intergenic
1152382329 17:79948550-79948572 CCACCCACGGGGAGATGGAGGGG + Intronic
1153188232 18:2509028-2509050 CTTACCACAGCGAGAATGGGTGG - Intergenic
1155019501 18:21882328-21882350 TTTACCACTGGGAGACGAGGAGG + Intergenic
1158325814 18:56313075-56313097 CTTGCCACAGCCAGATGGGGTGG - Intergenic
1158410321 18:57199484-57199506 CTTATCTCAGGGAGATGAGGAGG + Intergenic
1160586305 18:79915323-79915345 CTGGCCCCGGGGGGATGGGGAGG - Intronic
1160856018 19:1218323-1218345 ACTTCCACAGGGAGATGGGGAGG + Intronic
1161254757 19:3301703-3301725 CATACCTCAGGGAGTTGGGGCGG - Intergenic
1161608116 19:5225898-5225920 CTCAGCACGGGGAGTGGGGGTGG - Intronic
1162327514 19:10007678-10007700 CTCACCACGGGGAGCTGGGGCGG + Intronic
1163302620 19:16457489-16457511 CTTGCCACGGGGAGGGAGGGAGG + Intronic
1167595857 19:50427859-50427881 CTCACCACGGGGGGGGGGGGGGG - Intronic
930612864 2:53562749-53562771 CTTCCCAGAGGGAGGTGGGGAGG + Intronic
939477043 2:142700468-142700490 TTTACCACTGGGAGACAGGGAGG - Intergenic
942324824 2:174767157-174767179 CAGTCCAAGGGGAGATGGGGCGG - Intergenic
942754979 2:179329648-179329670 CTTACCACATGGCGATGGGGTGG + Intergenic
944448477 2:199816662-199816684 CTAGCCACGTGGAGATGTGGAGG - Intronic
947829076 2:233126017-233126039 GTGACCAGAGGGAGATGGGGAGG + Intronic
1173565197 20:44033558-44033580 CTTACAAGAGGGAGATGGGAGGG + Intronic
1174128646 20:48326668-48326690 CTGAGCACAGGCAGATGGGGTGG + Intergenic
1176240795 20:64074989-64075011 CTCCCCTGGGGGAGATGGGGTGG + Intronic
1176241224 20:64076808-64076830 CTCCCCTGGGGGAGATGGGGTGG - Intronic
1178303372 21:31470872-31470894 CTTGCCAAGGGGAGCTGGGCTGG + Intronic
949305850 3:2639918-2639940 CCTAGCACGGGGAAAGGGGGTGG - Intronic
950136385 3:10584144-10584166 CTGCCCAGGTGGAGATGGGGTGG + Intronic
950436658 3:12984256-12984278 AGGACCACGGGGAGATAGGGAGG + Intronic
954775205 3:53011009-53011031 CTTCCCAGGGGATGATGGGGTGG + Intronic
957713538 3:83895416-83895438 AGTACAACTGGGAGATGGGGAGG - Intergenic
961508710 3:127388341-127388363 CTCACCACAGGGAGAGGAGGAGG - Intergenic
961819348 3:129567324-129567346 CCTGCCACGGGGAGAAGGGTTGG - Intronic
962371890 3:134827711-134827733 CTTTCCCTGGGGAGCTGGGGTGG + Intronic
968188836 3:196652889-196652911 TTTACTGAGGGGAGATGGGGAGG - Intronic
969349685 4:6591257-6591279 CTCACCACGGGGTGAACGGGAGG - Intronic
978430079 4:108624363-108624385 TTTACCAATGGGAAATGGGGTGG + Intronic
982038883 4:151375186-151375208 ATTGCCACTGGGAGATGGAGAGG + Intergenic
986575572 5:9209075-9209097 TTTACCAAGGGGAAATGGGCTGG + Intronic
991368424 5:65893108-65893130 CTTACCTTGGGGAAATGGTGAGG + Intergenic
993013783 5:82512817-82512839 CTGACCACAGGGAGATGGTTAGG - Intergenic
993902938 5:93596601-93596623 CCCACTGCGGGGAGATGGGGTGG - Intergenic
996097724 5:119416578-119416600 CTTATGACGGCCAGATGGGGTGG + Intergenic
998164861 5:139837159-139837181 CCTCCCACGGGGCGCTGGGGAGG - Exonic
1000995099 5:167950540-167950562 CTTGCCTCAGGAAGATGGGGCGG - Intronic
1001575958 5:172763889-172763911 CTTAGCACTGGCAGATGGGTGGG + Intergenic
1002439306 5:179256100-179256122 CTTCCCACAGGGAGACCGGGAGG + Intronic
1003681337 6:8260380-8260402 CTAATCACTGGGAAATGGGGTGG + Intergenic
1004925911 6:20415019-20415041 CCTACCACGGGGAGTGGCGGGGG - Intronic
1011808444 6:91099866-91099888 CTTACAAAGGGGAGCTGGAGAGG - Intergenic
1014091908 6:117413618-117413640 CTTACCATTGGGAGAAGGGGTGG + Intronic
1018074906 6:160203275-160203297 CTTATCGCAGGGATATGGGGAGG + Intronic
1019561873 7:1663507-1663529 CTTGCGGCGGGGAGCTGGGGTGG + Intergenic
1019914325 7:4122961-4122983 CTTCTCACGTGGAGATAGGGAGG - Intronic
1021926705 7:25540801-25540823 CTAGCCATGGGGAGATGGGGAGG + Intergenic
1022280165 7:28900181-28900203 CTTACCACAGGGAGAAGAGTTGG - Intergenic
1022557531 7:31313842-31313864 CTTGCCACGGGAAGAGGTGGTGG - Intergenic
1031703938 7:124959132-124959154 CATATCATGGGGAGAGGGGGAGG + Intergenic
1035158085 7:156930343-156930365 CTTCCCACTGGGAGAAGGGGAGG - Intergenic
1035383003 7:158452404-158452426 GTCTCCACTGGGAGATGGGGAGG - Intronic
1038549924 8:28458425-28458447 TTTACCATGTGGAGATGAGGTGG - Intronic
1039532473 8:38275882-38275904 CCTAATTCGGGGAGATGGGGAGG + Exonic
1040409921 8:47143787-47143809 CTTCCCAGGGTGAGGTGGGGAGG - Intergenic
1042093788 8:65189450-65189472 CTTACAAAGGACAGATGGGGAGG - Intergenic
1044339140 8:91026799-91026821 CTTACCAATGGGAAATGGGATGG + Intronic
1047528114 8:125650986-125651008 CTTACCACAGGTGGCTGGGGTGG + Intergenic
1049353375 8:142175968-142175990 CTCCCCACAGGGAGATGGGTAGG - Intergenic
1057066727 9:92060020-92060042 CTGCCCAGGAGGAGATGGGGAGG - Intronic
1061809112 9:133152179-133152201 CTGGCCACGCAGAGATGGGGTGG - Intergenic
1195063308 X:101217276-101217298 CTTAAGACGGGGATATGGGTGGG - Intergenic
1199617858 X:149671926-149671948 CTTAATATGGGGAGATGGAGAGG - Intergenic
1199624784 X:149731323-149731345 CTTAATATGGGGAGATGGAGAGG + Intergenic
1201503774 Y:14675160-14675182 CTTACTAAGGGAAGATGGTGTGG + Intronic