ID: 916499364

View in Genome Browser
Species Human (GRCh38)
Location 1:165373741-165373763
Sequence TCTGTTTCACAGGGTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916499358_916499364 -8 Left 916499358 1:165373726-165373748 CCCAGCTCGGCCTTATCTGTTTC No data
Right 916499364 1:165373741-165373763 TCTGTTTCACAGGGTGCTGGAGG No data
916499359_916499364 -9 Left 916499359 1:165373727-165373749 CCAGCTCGGCCTTATCTGTTTCA No data
Right 916499364 1:165373741-165373763 TCTGTTTCACAGGGTGCTGGAGG No data
916499357_916499364 -1 Left 916499357 1:165373719-165373741 CCAGGAGCCCAGCTCGGCCTTAT No data
Right 916499364 1:165373741-165373763 TCTGTTTCACAGGGTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916499364 Original CRISPR TCTGTTTCACAGGGTGCTGG AGG Intergenic
No off target data available for this crispr