ID: 916500940

View in Genome Browser
Species Human (GRCh38)
Location 1:165386137-165386159
Sequence GCTTAAAGATTTCACAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916500940_916500944 24 Left 916500940 1:165386137-165386159 CCTGGGTTGTGAAATCTTTAAGC No data
Right 916500944 1:165386184-165386206 GTATTTCATTTAAATTCACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916500940 Original CRISPR GCTTAAAGATTTCACAACCC AGG (reversed) Intergenic
No off target data available for this crispr