ID: 916501956

View in Genome Browser
Species Human (GRCh38)
Location 1:165394991-165395013
Sequence CTTAACATCCTACCCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916501948_916501956 30 Left 916501948 1:165394938-165394960 CCACTGTGCCCATGAAGGGTAAC No data
Right 916501956 1:165394991-165395013 CTTAACATCCTACCCAGGACAGG No data
916501953_916501956 -10 Left 916501953 1:165394978-165395000 CCTCATACCTTATCTTAACATCC No data
Right 916501956 1:165394991-165395013 CTTAACATCCTACCCAGGACAGG No data
916501951_916501956 21 Left 916501951 1:165394947-165394969 CCATGAAGGGTAACTTGGCAGTC No data
Right 916501956 1:165394991-165395013 CTTAACATCCTACCCAGGACAGG No data
916501950_916501956 22 Left 916501950 1:165394946-165394968 CCCATGAAGGGTAACTTGGCAGT No data
Right 916501956 1:165394991-165395013 CTTAACATCCTACCCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916501956 Original CRISPR CTTAACATCCTACCCAGGAC AGG Intergenic
No off target data available for this crispr