ID: 916503836

View in Genome Browser
Species Human (GRCh38)
Location 1:165409690-165409712
Sequence GACCTCCTCCTTATCCTTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916503836_916503839 25 Left 916503836 1:165409690-165409712 CCTGCAAGGATAAGGAGGAGGTC 0: 1
1: 0
2: 0
3: 9
4: 168
Right 916503839 1:165409738-165409760 TCTTTACTTATAATCACCCAAGG 0: 1
1: 0
2: 0
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916503836 Original CRISPR GACCTCCTCCTTATCCTTGC AGG (reversed) Exonic
901202261 1:7473410-7473432 GTCCTCCTCCTCCTCCTTGGGGG - Intronic
901546378 1:9960914-9960936 TACTTCCTCCATATCATTGCAGG - Intronic
902281948 1:15381310-15381332 GACCTTCTCCCTCTCCTGGCGGG - Exonic
902568937 1:17334051-17334073 GCCCACCTCCTAATCCCTGCAGG + Intronic
903067861 1:20710834-20710856 GACCTTCACCTTCTCCTTTCTGG - Intronic
904771656 1:32884566-32884588 ATCCTCCTCTTTATCCTTGGGGG - Intergenic
905397693 1:37677630-37677652 GTCCTCCTCCCCATCCTTCCTGG - Intergenic
905770798 1:40636810-40636832 GGCCTCCCCCTCAGCCTTGCAGG + Intronic
906348037 1:45033037-45033059 GTCCTCCTCCTTATCCTGCTTGG + Intronic
909445616 1:75744994-75745016 TAGTCCCTCCTTATCCTTGCAGG + Intronic
911337120 1:96594583-96594605 GACCTCCTCATTCTGCTTGTTGG - Intergenic
913564806 1:120062418-120062440 GACCTCCAGCTCACCCTTGCTGG - Intronic
913633325 1:120731145-120731167 GACCTCCAGCTCACCCTTGCTGG + Intergenic
914285393 1:146221768-146221790 GACCTCCAGCTCACCCTTGCTGG - Intronic
914546424 1:148672523-148672545 GACCTCCAGCTCACCCTTGCTGG - Intronic
914620142 1:149398147-149398169 GACCTCCAGCTCACCCTTGCTGG + Intergenic
916181102 1:162084501-162084523 GGCCTCCTCCACCTCCTTGCTGG - Intronic
916503836 1:165409690-165409712 GACCTCCTCCTTATCCTTGCAGG - Exonic
916579471 1:166094728-166094750 GATGTCCTCCTTATCTTTTCAGG - Intronic
919126954 1:193406495-193406517 TCCCTCCTTCTTATCCTTCCTGG + Intergenic
921052484 1:211520853-211520875 AACCTTCTCCTTAGCCTGGCTGG - Intergenic
924476506 1:244386531-244386553 CAACTCCTCATGATCCTTGCAGG - Intronic
1064223308 10:13460170-13460192 GACTTCCTCCTTTTGTTTGCTGG - Intronic
1065411592 10:25435403-25435425 CACCTCCTGGTTATCCTTGAGGG - Intronic
1066612094 10:37259985-37260007 CACCTCCTCCCTATCCTCCCAGG - Intronic
1072746898 10:97946638-97946660 AACCACATCCTTATCCTTCCTGG - Intronic
1073028661 10:100507391-100507413 GACGTCATCCATATCCTTGGGGG - Intronic
1076692931 10:132233023-132233045 AACCACCTCCTAATCCTTCCTGG + Intronic
1076997626 11:306452-306474 GTCCTCCTCCTTCTGCTGGCTGG - Intergenic
1077392504 11:2306715-2306737 CTCCTCCTCCTCCTCCTTGCTGG - Intronic
1081204036 11:40254092-40254114 GACCTTTCCCGTATCCTTGCAGG + Intronic
1081627922 11:44666518-44666540 GTCCTCTTCCTTTTACTTGCTGG + Intergenic
1084964600 11:72738104-72738126 CACCTCCTACTTATCCTTCAAGG - Intronic
1085045932 11:73353364-73353386 GACCTCCACCCTATCTTTACTGG + Intronic
1088402422 11:109435913-109435935 GACCTACTCCTTATCTTCTCAGG + Intergenic
1095360925 12:41337748-41337770 GACTTCATCCTCATCTTTGCAGG - Intronic
1096195636 12:49647324-49647346 TACCTCCTCCTGCTTCTTGCGGG + Exonic
1096690097 12:53315257-53315279 GCCCTCATTCCTATCCTTGCAGG - Intronic
1098362719 12:69670578-69670600 GCCCTCCTCCTTCTACTTTCAGG - Intronic
1102619522 12:114182877-114182899 GACCTCATTCTTAGCCTTGTGGG + Intergenic
1102877663 12:116460342-116460364 GAACTCCTCCATCTCCTTCCCGG + Intergenic
1102960111 12:117087009-117087031 GACAGCCTCCTTAGCCTTGCAGG + Intronic
1107150474 13:37105333-37105355 GCCCTCATCCTCAGCCTTGCGGG - Exonic
1109922650 13:69089017-69089039 GACCTGCTTCTTATTTTTGCAGG + Intergenic
1110425561 13:75362521-75362543 GGCGTCCTCATTATCTTTGCTGG + Exonic
1111518217 13:89363195-89363217 CACCTCCTCCTTGTCGTCGCCGG + Intergenic
1112895866 13:104298986-104299008 GACATCCTCCTTTTCCCAGCAGG - Intergenic
1116239157 14:42319201-42319223 CCCCTCCTCCATATCTTTGCAGG - Intergenic
1116407010 14:44578943-44578965 GACCTCTTCCTTCTGCTTGAGGG + Intergenic
1119752930 14:77093212-77093234 GGCCTCCTCCTTAGCATAGCAGG + Intergenic
1119786646 14:77319560-77319582 GACCTCCTCTTTGTCCTGGAGGG - Intronic
1122495934 14:102155389-102155411 CAGTTCCCCCTTATCCTTGCAGG - Intronic
1123106765 14:105845388-105845410 GATCTCCTTCTTACTCTTGCTGG + Intergenic
1126671628 15:51120741-51120763 GACATCCTCCTTATACCTGGAGG - Intergenic
1127545480 15:59990820-59990842 GTTCTCCTCCTTATCCATGGGGG - Intergenic
1127730966 15:61801659-61801681 GCCCTCCTCCTCATGCTTCCAGG + Intergenic
1128234535 15:66058755-66058777 CACCTCCTCCTCCTCCTTCCTGG - Intronic
1128476531 15:68001599-68001621 GACTTCCTCCATTTCCTTCCTGG + Intergenic
1128648272 15:69392817-69392839 GTCCTCATCCTTGTCCTGGCTGG - Intronic
1128878739 15:71223941-71223963 GAAGTACTCCTTATCCTTGAGGG + Intronic
1129187666 15:73920007-73920029 GACCTCCTCTTCATCCAGGCAGG + Intergenic
1129209972 15:74062771-74062793 GACATTCTCCTCAGCCTTGCTGG - Intergenic
1131460402 15:92613896-92613918 GACCTGCTCCTAATGCCTGCTGG + Intergenic
1131779721 15:95843370-95843392 GATCTGCTCCTTATCCTCTCTGG - Intergenic
1132378758 15:101350705-101350727 CAGCTCCTCTTTATGCTTGCGGG - Intronic
1132848202 16:2010465-2010487 GGCCTCCTCCCTACCCTTGAGGG + Intronic
1133013032 16:2925382-2925404 GCCCTCATCCTCATCCTTCCTGG + Intronic
1134202751 16:12212371-12212393 GACCTGCTCTTTGTCCTTGAAGG + Intronic
1136429248 16:30187360-30187382 TACCACCTCCCTTTCCTTGCAGG + Exonic
1136579357 16:31142493-31142515 CACCTCCTCCTTTTCCTGGTAGG + Exonic
1140113441 16:72022435-72022457 AATGTCCTCCTTATCCTGGCTGG - Exonic
1140328104 16:74025446-74025468 ACCCTCCTTCTTATCCTTTCTGG - Intergenic
1141556264 16:84838650-84838672 GATCTCCTCCTTGTCCTCCCTGG - Exonic
1141968625 16:87464449-87464471 GGTCTCCTCTTTGTCCTTGCCGG - Intronic
1143176335 17:4957242-4957264 CACCTCCTCTTTGTCCTAGCAGG - Intergenic
1143592658 17:7894909-7894931 GACCCCCTCCTTCTCCTAGGGGG - Exonic
1143729375 17:8872336-8872358 GACCTCCTCCTTCTCTTTTGCGG + Intergenic
1144516031 17:15917962-15917984 GTCCTCCTCCGTATCCTTGTGGG + Intergenic
1144799337 17:17914310-17914332 GTCCTCCCCCTTAACCTTCCTGG + Intronic
1145898202 17:28473149-28473171 GTCCTCCTCCTCCTCCTTCCAGG - Intronic
1147768067 17:42850060-42850082 CAGCTCCTCCTTCTTCTTGCAGG + Exonic
1147793215 17:43025747-43025769 GACCTCCTCCTGTTCCCTTCTGG - Intronic
1148664318 17:49362755-49362777 GACCTCCTTGTTCTCCTTGGAGG + Intergenic
1149432784 17:56607791-56607813 GACCAACACCTTCTCCTTGCAGG + Intergenic
1153607789 18:6852687-6852709 GACCTAATCCTTATTCTTACAGG + Intronic
1155437282 18:25826480-25826502 GCCCTCATCCTTAGCCTGGCTGG + Intergenic
1155681017 18:28486246-28486268 GAGTTCTTCCATATCCTTGCTGG - Intergenic
1158705986 18:59792508-59792530 AACCTCCTGCTCCTCCTTGCTGG + Intergenic
1161324932 19:3659019-3659041 CACCTCCGCCTTCTCCTTCCTGG + Intronic
1163289644 19:16370918-16370940 GACCCCCTCCCCATCCTGGCTGG + Intronic
1164400277 19:27897363-27897385 GTCCTCCTCCTCATCTTTGGAGG + Intergenic
1164412888 19:28020556-28020578 GACCTCCTCCCTCTATTTGCCGG + Intergenic
1164517382 19:28947980-28948002 GACCTCCTCCCTCTACTTGCAGG + Intergenic
1164776207 19:30855607-30855629 GACCTCCTCATAACCCTGGCCGG + Intergenic
1202682531 1_KI270712v1_random:20547-20569 TCCGTCCTCCTTCTCCTTGCAGG + Intergenic
925270638 2:2604777-2604799 GAGATCCACCCTATCCTTGCTGG - Intergenic
926337787 2:11877162-11877184 ACCCCTCTCCTTATCCTTGCAGG + Intergenic
928077750 2:28280643-28280665 TCCCTCCTCCTGATCCGTGCTGG + Intronic
929054344 2:37862990-37863012 TCCCTCCTCCTCATCCTGGCAGG + Intergenic
930474052 2:51856220-51856242 GACCTCCTACTTAGCCAGGCTGG + Intergenic
931933627 2:67170033-67170055 GAGCTCTTCCTTATCTTTCCTGG - Intergenic
932770479 2:74498318-74498340 GACCCCCTCCCTATCCCTACAGG - Exonic
933517623 2:83325995-83326017 AACCTCCTTCTTATCCCAGCAGG + Intergenic
937036535 2:118786849-118786871 CACCTCCTCCCTGTCCTGGCTGG - Intergenic
937797089 2:126036452-126036474 TGCCTTCTCCTTTTCCTTGCAGG + Intergenic
938573297 2:132582206-132582228 GATCACCTCCATATGCTTGCGGG + Intronic
938732070 2:134154384-134154406 GTCCTCCTCCATATCCTGCCAGG + Intronic
938736555 2:134191515-134191537 CTCCTCCTCCTCCTCCTTGCGGG + Intronic
939194023 2:138950193-138950215 GACCTCCTACTTGTCCTTCAAGG + Intergenic
939598206 2:144154316-144154338 GACCTCCTCCTTGTTATTCCAGG - Intronic
939607037 2:144265755-144265777 GACCTCCTCCTCTTCCTTTAAGG + Intronic
942174423 2:173318154-173318176 GTCTTCCTCCTTATCCTTGGAGG - Intergenic
943796013 2:191995151-191995173 CACCTCCTGCTGATCCTTGCTGG + Intronic
946368582 2:219266446-219266468 AGCCTCCTCCTTATACTCGCTGG - Intronic
947272508 2:228352718-228352740 GATCTCCTGCTTGTGCTTGCTGG + Intergenic
947324666 2:228961411-228961433 GACCTCCTCCCTATGTCTGCTGG + Intronic
948707368 2:239803397-239803419 GAGCTCCTCCTTATCCTCACAGG + Intergenic
1169545701 20:6648458-6648480 TACTTCCTCCTTATCCCTGATGG - Intergenic
1173183312 20:40820732-40820754 TAACTCCTGCTTATCCTTGAAGG + Intergenic
1173201028 20:40955257-40955279 GCTCTCCTCCTTGTCCCTGCAGG - Intergenic
1173825117 20:46043274-46043296 GACCTCCTACTTCACCCTGCTGG + Exonic
1173868174 20:46326128-46326150 GACCTCATCTTTAGCCTTTCAGG - Intergenic
1180966396 22:19789999-19790021 GCCTTCCTCCTCAGCCTTGCAGG - Intronic
1181235602 22:21446076-21446098 GTTCTCCTCCTCCTCCTTGCAGG - Exonic
1184309645 22:43633021-43633043 GACCTTCTCCTGAGCGTTGCTGG - Intronic
951711883 3:25591826-25591848 GCCTTCCTCCTTATCCACGCTGG + Intronic
951731245 3:25812787-25812809 GACCTCCTAGCTGTCCTTGCTGG + Intergenic
951981105 3:28568062-28568084 GGCCTCCTCCTTTTTCTTTCTGG + Intergenic
953876235 3:46668314-46668336 GACCACCTGCTTATCCTAGACGG - Intergenic
954743810 3:52775226-52775248 AACCTTCTCCTAATCCCTGCAGG + Intergenic
956794174 3:72703075-72703097 AACCTCCCCCTCATCCTTTCTGG - Intergenic
957497205 3:81007584-81007606 GACATCTTTCTTATCCTTGTAGG - Intergenic
960576828 3:119238761-119238783 GTCGTCCTCCTTATTCTTGGGGG - Intronic
960623078 3:119654826-119654848 TTCCTCCTCCTTCTCCTTACTGG + Intronic
961522615 3:127475672-127475694 GAACTCCTCTTTGTCCTTGGAGG + Intergenic
962007338 3:131361806-131361828 TTCCTCCCCCTTATCCCTGCAGG + Intergenic
964590817 3:158360775-158360797 GACCTCCGCCTTGCCCTTGCAGG - Intronic
967009959 3:185423475-185423497 GATCTCCTCATTATACTTTCTGG - Intronic
969172312 4:5373974-5373996 GACCTCATCCTTATTCTTACCGG - Intronic
970001879 4:11372773-11372795 GACCTTCTCCTCATCCGTGGGGG - Intergenic
975242875 4:72082266-72082288 GAGCTCCTCCTATTCCTTGAAGG - Intronic
979446544 4:120820405-120820427 GGCCTCGTCTTTATCCTTTCAGG - Intronic
979711802 4:123788638-123788660 GTCCTGCCCCTTATCCTTGTTGG - Intergenic
987918781 5:24250835-24250857 TTCCACCTCCTTATCCTGGCAGG + Intergenic
992518801 5:77525618-77525640 GCCCTCTTCCTTCACCTTGCAGG + Intronic
997892606 5:137688325-137688347 GCCCTCCTACTTTTCCTGGCTGG - Intronic
999211591 5:149894188-149894210 GACCTCCTTTTTGTCCTTGTTGG + Intronic
1002304638 5:178275927-178275949 GGTCTCCTCCATCTCCTTGCTGG + Intronic
1002636499 5:180611465-180611487 GACCTCCTCTTCCTCCTGGCGGG + Exonic
1004276668 6:14242584-14242606 GGCCTCCTCCTTTTTGTTGCTGG - Intergenic
1005055234 6:21722755-21722777 GGGCTCCTCCTTATCTTCGCAGG + Intergenic
1006316437 6:33294685-33294707 GACCTCCAACTCATCCTTGGAGG + Exonic
1007307297 6:40917125-40917147 GATCCCCTCCTTCTGCTTGCAGG - Intergenic
1007740687 6:44007911-44007933 CACCCCCTCCTCATCCTTTCGGG - Intergenic
1013000492 6:106017496-106017518 CACCTCCACCCTACCCTTGCCGG + Intergenic
1014024143 6:116625265-116625287 GAACTCCTGCTTATCCTTCATGG - Intronic
1014756266 6:125304489-125304511 GAGCTCCTCCTGATTCATGCAGG + Intergenic
1015445204 6:133296129-133296151 GAGCTCCTCCTTTTGCTTGTAGG - Intronic
1017817776 6:158027824-158027846 GAACTCCTCCTCATCCTTCTGGG - Intronic
1019569757 7:1705430-1705452 GAGCTCCTCCTCCTCCTTCCAGG - Intronic
1023843157 7:44107844-44107866 GGCCTCCTCCTTCTGCTTGGGGG - Exonic
1024554046 7:50588016-50588038 GTCCTCCTCCATATCCGTGATGG - Intergenic
1024599031 7:50963334-50963356 CTCCTCCTCCTCATCTTTGCTGG + Intergenic
1026229277 7:68469236-68469258 TTCCTCTTCCTTATCCTTACTGG - Intergenic
1031972275 7:128073478-128073500 GACCACCTCCTTGTCCTTCTGGG + Intronic
1033055244 7:138046730-138046752 CACCTTCTCATTATCCTGGCTGG + Intronic
1035404633 7:158589004-158589026 GACCTCCGTCATCTCCTTGCTGG + Intergenic
1038785592 8:30612349-30612371 GAATTCCTCCTAATCCTCGCTGG + Exonic
1041012473 8:53558577-53558599 GACCTCCTCCCTTTCCTGGGTGG - Intergenic
1042508096 8:69582726-69582748 GGCCTCCTCCTCATCCCTACGGG - Intronic
1045382827 8:101643978-101644000 AACCTCCTTCTTCCCCTTGCAGG - Intronic
1049088283 8:140494509-140494531 GAGCTCCTCCTTGTCCTTCAAGG + Intergenic
1059522219 9:114953893-114953915 GACCTCCCCAATGTCCTTGCTGG - Intergenic
1060224670 9:121783695-121783717 GGCCTCCTCCTCACCCTTCCCGG + Exonic
1062332803 9:136051871-136051893 CTCCTCCTCCTCCTCCTTGCCGG - Intronic
1187828211 X:23354196-23354218 TACCTCCTCCTCATCCATGCTGG - Intronic
1197108115 X:122740064-122740086 GAAGTTCTCCTTATCTTTGCAGG + Intergenic
1200953922 Y:8927030-8927052 GACATCCTCCTTAACCTGGGTGG - Intergenic