ID: 916511169

View in Genome Browser
Species Human (GRCh38)
Location 1:165473622-165473644
Sequence ATGGCCTAGCAGCTGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916511165_916511169 0 Left 916511165 1:165473599-165473621 CCCTTTGAACAGATGAAAACTAA No data
Right 916511169 1:165473622-165473644 ATGGCCTAGCAGCTGGAGTGAGG No data
916511166_916511169 -1 Left 916511166 1:165473600-165473622 CCTTTGAACAGATGAAAACTAAA No data
Right 916511169 1:165473622-165473644 ATGGCCTAGCAGCTGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916511169 Original CRISPR ATGGCCTAGCAGCTGGAGTG AGG Intergenic
No off target data available for this crispr