ID: 916511258

View in Genome Browser
Species Human (GRCh38)
Location 1:165474089-165474111
Sequence ACCTCAGAGATCCTACATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916511255_916511258 24 Left 916511255 1:165474042-165474064 CCTTCAACTTCAGCTCGAGGATT No data
Right 916511258 1:165474089-165474111 ACCTCAGAGATCCTACATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916511258 Original CRISPR ACCTCAGAGATCCTACATGA AGG Intergenic
No off target data available for this crispr