ID: 916517212

View in Genome Browser
Species Human (GRCh38)
Location 1:165530477-165530499
Sequence CAAAATGTTAATAGTGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916517207_916517212 17 Left 916517207 1:165530437-165530459 CCACAACTGTATCTGCATAGAAT No data
Right 916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916517212 Original CRISPR CAAAATGTTAATAGTGATAA TGG Intergenic
No off target data available for this crispr