ID: 916518595

View in Genome Browser
Species Human (GRCh38)
Location 1:165543541-165543563
Sequence CAGTGTTGCCAGAAGAAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916518595 Original CRISPR CAGTGTTGCCAGAAGAAGAT GGG (reversed) Intergenic
906121191 1:43392282-43392304 CAATGTTGCTAGACCAAGATGGG - Intronic
906651799 1:47518016-47518038 CTGTGTTGCCAGAGTAAGATGGG - Intergenic
907146737 1:52240905-52240927 CAGTGTTGCCTGAAAAAAAGTGG + Intronic
907874981 1:58477030-58477052 CAGTATTGCCAAAAGAACACTGG + Intronic
908071324 1:60463437-60463459 CAGATTGGCCAGAAGAAGACAGG + Intergenic
909071177 1:70995280-70995302 CAGTGTTGCCAGAAAAAAATTGG + Intronic
911004556 1:93205090-93205112 CACTGTTGAGAGGAGAAGATTGG - Intronic
911032375 1:93503292-93503314 CACTGTTGTGAGAACAAGATGGG + Intronic
912443711 1:109717431-109717453 CAGTGATGCCAGAAGATGGGAGG + Exonic
915444475 1:155966960-155966982 CTGTGTGGCCAGGAGGAGATGGG - Intronic
916100342 1:161388837-161388859 CCTTGTGGCCAGAAGAAGCTAGG + Intergenic
916215016 1:162386665-162386687 CAGCGTTTAAAGAAGAAGATTGG + Intronic
916518595 1:165543541-165543563 CAGTGTTGCCAGAAGAAGATGGG - Intergenic
916647831 1:166804974-166804996 CAGTGTGGCCTCATGAAGATAGG + Intergenic
919962945 1:202490639-202490661 CAGCGTTGCCAGAGGGAAATGGG - Intronic
920118235 1:203636405-203636427 CAGGGTTTCCAGGAGAAGAGAGG - Intronic
920607985 1:207408790-207408812 CAGATTTCCCTGAAGAAGATGGG - Intergenic
922691859 1:227699323-227699345 CAGTGTTATAAGAAGAAAATAGG - Intergenic
924052948 1:240095125-240095147 CACTTTTGATAGAAGAAGATTGG + Intronic
924544281 1:245010576-245010598 CAGTGTGGCCAGATGAAGTCAGG - Intronic
1063516132 10:6697590-6697612 CAATCTCGCCATAAGAAGATAGG + Intergenic
1064740976 10:18434386-18434408 CAGTGTAGCCAGTAGAATTTGGG + Intronic
1065371653 10:24992877-24992899 CAGTGTTTCCTGAAGTGGATTGG - Intronic
1066260790 10:33727874-33727896 CAGTGCTGCAAGAAGATGACTGG + Intergenic
1068265074 10:54637191-54637213 TAGTGTTCCAAGAAGATGATGGG - Intronic
1069726711 10:70584853-70584875 TACTGTTGCCAGAAAAAGAGGGG - Intergenic
1069924142 10:71836601-71836623 CAGGGAAGCCAGAAGAGGATGGG + Intronic
1072993937 10:100226647-100226669 TAATGTTGCCAGAATATGATGGG - Intronic
1075057824 10:119233198-119233220 TGCTGTTGCCAGAAGAAGAGGGG - Intronic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1076616974 10:131761527-131761549 CACTGTGGGGAGAAGAAGATGGG + Intergenic
1078608828 11:12801678-12801700 CAGTGATGCCAGAAGATGGTTGG + Intronic
1079009112 11:16813796-16813818 CAGAGATGCCACAAGCAGATAGG - Intronic
1079754664 11:24241120-24241142 AACTGTTGACAGTAGAAGATTGG - Intergenic
1079900579 11:26178526-26178548 CATTGTTGTCAGAATTAGATAGG + Intergenic
1081687972 11:45055985-45056007 CAGTCATGGCAGAAGAAGAAAGG + Intergenic
1086152763 11:83630610-83630632 CTGTGCTGACAGAAGCAGATTGG + Intronic
1086763274 11:90660824-90660846 CAGTGCTGCCAGAATAAAAGCGG - Intergenic
1087052673 11:93902205-93902227 CAGTTTTGCCAGATGAAAAGAGG + Intergenic
1087265013 11:96050940-96050962 CAGTCTGCCCAGAAGAATATAGG - Intronic
1087816271 11:102662467-102662489 TAGTCTTGCCAGAAGAGGAAGGG + Intergenic
1087890925 11:103537164-103537186 CAGAGTTGCCAGTCTAAGATGGG - Intergenic
1088332205 11:108665503-108665525 CAGTGTGGCAAGCAGAAGAGTGG - Intronic
1088722608 11:112607736-112607758 CAGTGTTTCCAGATTATGATTGG + Intergenic
1090621663 11:128566200-128566222 GGGTGCTACCAGAAGAAGATGGG - Intronic
1095838261 12:46662621-46662643 CAGTGTTGCCACAAAAACAATGG + Intergenic
1096073520 12:48788754-48788776 CAGTGTTGCCCGAGGGAGTTGGG - Intronic
1097055664 12:56247757-56247779 CAGTGTGGCCAGAGGCAGCTAGG + Exonic
1100331139 12:93583260-93583282 ATGTGTTCCCAGAAGATGATGGG + Intronic
1100384853 12:94096313-94096335 CAAAGTAGGCAGAAGAAGATGGG - Intergenic
1101219688 12:102625484-102625506 AAGTGTTGCCTGAAGATGATAGG - Intergenic
1101229044 12:102721019-102721041 CAGTGTTTCCACATGGAGATAGG - Intergenic
1102141982 12:110622663-110622685 CAGTGTGGCCAGAAGAGGGGTGG + Intronic
1106027358 13:25967975-25967997 AGTTGTTGCCAGAGGAAGATGGG + Intronic
1108090770 13:46847298-46847320 CAGAGATGCCAGAAAAAGAGAGG - Intronic
1108490565 13:50977285-50977307 CAGGGTTGCCAGGTGTAGATGGG + Intergenic
1109556963 13:63989676-63989698 CAGTGTGGCAACAAGAAGATAGG + Intergenic
1110561145 13:76911863-76911885 CAGTGTTGGGGGAAGAGGATAGG - Intergenic
1110621241 13:77598389-77598411 CATTATTGCCAGAACAGGATAGG - Intronic
1116444358 14:44991327-44991349 CAGTGCTGACAGAAGGAGACTGG - Intronic
1116615941 14:47138928-47138950 CAATGTTTCCAGAAAAAAATTGG - Intronic
1116695148 14:48165571-48165593 TATTGTTGCTAGAAGAATATTGG + Intergenic
1116723759 14:48534224-48534246 CAGTGATGGCAGAAGGAGTTGGG + Intergenic
1118249107 14:64141623-64141645 CAGTGGTGCCAGAGAAAAATAGG - Intronic
1121287216 14:92745761-92745783 CAGTGTAGCCACTAGCAGATTGG - Intronic
1128828552 15:70744635-70744657 CAGGGGTGACAGAAGAAAATGGG + Intronic
1129323306 15:74786743-74786765 CAGGGTTGCCAGGAGGAGACTGG - Intronic
1130113110 15:80982658-80982680 CAGTGTTGCCTGTAGAAGGGGGG + Intronic
1132367628 15:101269045-101269067 CAGTTGTGCCAGAGGAAGACTGG + Intergenic
1133662501 16:7932968-7932990 CAGTGTGGCCAGAATAAAAGCGG - Intergenic
1133931532 16:10236658-10236680 CACTGGTCCCAGAAGAGGATGGG - Intergenic
1135150944 16:20005134-20005156 GAGTGATGCCAGAAGAGGACAGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138206000 16:55125493-55125515 CAGTGTGGCCAGAACAGGGTAGG + Intergenic
1139045177 16:63049054-63049076 AAGTTTTGCCAAACGAAGATGGG + Intergenic
1139182445 16:64764116-64764138 GATTGTTGCAAGCAGAAGATGGG - Intergenic
1140092549 16:71850217-71850239 CAAGGTTGGCAGAAGGAGATAGG - Exonic
1141447314 16:84069437-84069459 CAAGGTTGCCAGAAGAGGAGTGG + Intronic
1143421779 17:6798895-6798917 CAGTGTTGCAACTAGAAGCTAGG + Exonic
1151164526 17:72192415-72192437 CAGATTTGGGAGAAGAAGATTGG + Intergenic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1155180521 18:23341522-23341544 CAGTGGTGCCAGAGGAGAATCGG - Intronic
1156291886 18:35754823-35754845 CTGAGTTGCCAGAGGAAGACTGG + Intergenic
1156366611 18:36433458-36433480 CAGTTTTAGCAGAAGAAAATAGG + Intronic
1156471128 18:37377879-37377901 CAGTGCTCTCAGAAGGAGATGGG + Intronic
1156749080 18:40428593-40428615 CAGTGATGACAGAAGATGGTAGG + Intergenic
1156802472 18:41133807-41133829 CAGGGATGCTAGGAGAAGATAGG - Intergenic
1156853413 18:41754909-41754931 CAGTTTTGAAAGAAGAACATAGG + Intergenic
1158090797 18:53710820-53710842 CATTTTTTCCAAAAGAAGATGGG - Intergenic
1160507764 18:79436926-79436948 CAATGTGGCCAGAAGAATAGGGG - Intronic
1167725249 19:51207695-51207717 CAGTCCAGCCAGAAGAACATAGG - Intergenic
1168548271 19:57271963-57271985 CAGTGGTGCCAGGAGACCATGGG - Intergenic
925813262 2:7722210-7722232 CAGTTTTGACAGAAAATGATAGG + Intergenic
926083226 2:10005468-10005490 AAGTGGTGAAAGAAGAAGATGGG + Intergenic
927470364 2:23371216-23371238 CAGTATTGCCGTAACAAGATGGG - Intergenic
929238657 2:39630999-39631021 CAGTTTTTCCAGAAGAAAATTGG - Intergenic
934544303 2:95201921-95201943 TAGTGTTGACAGAAGAAGAGAGG + Intergenic
935107005 2:100054111-100054133 CAGTGTGGCAGGAAGAACATAGG + Intronic
936963580 2:118103141-118103163 AAGTGTTGCCAGTACAACATTGG + Intronic
937213163 2:120291085-120291107 AAGTGATGCTAGAAGAACATTGG + Intronic
937997912 2:127708928-127708950 CAGTGTGACCAGAAGTAGATGGG + Intronic
939453873 2:142408161-142408183 CAGTGTTGCCAGAAAGAATTGGG - Intergenic
941221682 2:162788944-162788966 CCTTGATGCCAGAAGATGATGGG + Intronic
941307256 2:163885574-163885596 AAGGATTGGCAGAAGAAGATAGG - Intergenic
941757818 2:169206867-169206889 CAGTGATGCCATAAGGAGTTGGG + Exonic
944677601 2:202047231-202047253 CACTGTTGGAAGAAGAAGGTGGG + Intergenic
946161607 2:217839191-217839213 CCGTGTGGCCAGAGGAAGAAAGG + Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
947789767 2:232858257-232858279 CATTGTTGCCTGAAGAAGGCTGG + Exonic
948735899 2:240004650-240004672 CAGTGTGGCCAGAAAAAGTGTGG - Intronic
1169358448 20:4927413-4927435 CAGAGCTGGCAGAGGAAGATAGG - Intronic
1169523530 20:6398743-6398765 CAGTGTAGTCAGAAAAAAATTGG + Intergenic
1169846287 20:9995708-9995730 CATTGTTGCCAGAATAATCTTGG + Intronic
1170761971 20:19258911-19258933 AATTATTGCCAGAAGGAGATAGG - Intronic
1172795551 20:37534811-37534833 CAGTGGTGATATAAGAAGATGGG - Intergenic
1173408803 20:42791396-42791418 CAGGGTTGGCAGGAGAAGGTGGG + Exonic
1177196097 21:17905059-17905081 CATTGATGCCAGTAGAAGACAGG - Intronic
1177846194 21:26290139-26290161 CAGTGTTGGCTGCAGAAGGTGGG + Intergenic
1178793473 21:35721993-35722015 CAGTGTAGCCACAAGGAGAGAGG - Intronic
1180061670 21:45388495-45388517 CAGGGTGGCCAGAAGAGGACAGG + Intergenic
1182314263 22:29433456-29433478 CAGTTTTCCCAGCAGGAGATGGG - Intergenic
950687533 3:14629151-14629173 CAGTGTGGCCTGAAGAGGCTGGG + Intergenic
951976701 3:28518309-28518331 CAGTGTTGACAGAAGATGATTGG + Intronic
952014466 3:28940521-28940543 CAGTGTTTACAGAGGAAGAAGGG - Intergenic
952983861 3:38760247-38760269 CAGTGTTCCCAGAAAAACAGTGG - Intronic
954080298 3:48209613-48209635 CAGTCTTGCCTGAACTAGATTGG + Intergenic
954673837 3:52304905-52304927 CAGTGCTGCCAGGAGGAGAGAGG + Intergenic
954800725 3:53185655-53185677 CAGGGTTTCGAGAAGAAGACCGG + Exonic
955772632 3:62401272-62401294 AATTGTTGCCAGAATATGATGGG + Intronic
955928972 3:64036720-64036742 GTGTGTTGCCAGAAGAAGAAGGG + Intergenic
956489715 3:69757878-69757900 CAGTGTTGCCTGTGGAAAATGGG + Intronic
956947318 3:74237861-74237883 CATTGTTCTCAGAAGAAGTTGGG + Intergenic
957116008 3:76027597-76027619 CACTGTTGTCAGAAAAGGATGGG - Intronic
960817893 3:121692014-121692036 CAGTGTTTCCATAAGCTGATTGG + Exonic
961685341 3:128626005-128626027 CAATGTTCCTGGAAGAAGATGGG + Exonic
962184136 3:133240502-133240524 CACTGTTGGCAGAAGAATGTAGG + Intronic
964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG + Intergenic
964881906 3:161432375-161432397 CAGTCTTGCCAGAAGATTAGTGG + Intergenic
965704442 3:171491951-171491973 TAGTATTGCCAGGAGAAAATGGG - Intergenic
970108616 4:12612843-12612865 CAGTGGTGCCAAAAGTAGAGAGG - Intergenic
970320959 4:14874963-14874985 CAGCTGTGCCAGAAGAAGATGGG + Intergenic
972704592 4:41529656-41529678 CACTGTTCCCAGTTGAAGATGGG + Intronic
973035739 4:45403848-45403870 CAGTGATGCTAGAATAAAATAGG - Intergenic
973113493 4:46425357-46425379 CAGAGTGGCTAGAAGAAGATAGG - Intronic
973260809 4:48161425-48161447 CAGTGTAGGGAGGAGAAGATCGG - Intronic
976179893 4:82389143-82389165 CAGGGTTTTCAGTAGAAGATTGG - Intergenic
976204671 4:82613447-82613469 CAGTGTGGCTAGAACAAGGTAGG - Intergenic
976607910 4:86999831-86999853 CAGTGATGGCAGAAGGAGACTGG + Intronic
978359571 4:107915640-107915662 CAGTGTTTCCACAGGATGATGGG - Intergenic
980044776 4:127975250-127975272 CAGTTTTGCAAGAAGAAAACTGG - Intronic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981929678 4:150176008-150176030 CAGCTATGGCAGAAGAAGATAGG + Intronic
983165003 4:164464719-164464741 TAGTGTTTCCATAAGAAGATGGG - Intergenic
983534864 4:168846675-168846697 CAGTCTACCCAGAGGAAGATAGG + Intronic
987739474 5:21887524-21887546 CAGTGTCTCCAGAGGAAGAATGG - Intronic
987803790 5:22734604-22734626 CAGTGTTTGGAGAAGAAGTTGGG - Intronic
989139080 5:38184584-38184606 GAGTGTTCACTGAAGAAGATTGG - Intergenic
989436433 5:41418679-41418701 CAGTGTGGCAGGAAGAAGAGAGG - Intronic
990495702 5:56345687-56345709 CAGTTAGGCCAGAAGAATATTGG - Intergenic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
991761966 5:69926723-69926745 AAGAATTGCCAGAAGAACATGGG - Intergenic
991785362 5:70191377-70191399 AAGAATTGCCAGAAGAACATGGG + Intergenic
991841194 5:70801772-70801794 AAGAATTGCCAGAAGAACATGGG - Intergenic
991877807 5:71191770-71191792 AAGAATTGCCAGAAGAACATGGG + Intergenic
991950889 5:71945946-71945968 CAGTGTGGCCACAAGGAGAGGGG + Intergenic
992223393 5:74594781-74594803 CACTGTGTCCAGGAGAAGATAGG - Intergenic
992950943 5:81857443-81857465 CACTGTTCCAAGGAGAAGATTGG + Intergenic
994355806 5:98792793-98792815 CAGTGTTGCTATCAGAATATCGG - Intronic
996903843 5:128575359-128575381 GAGTCTTCCCAGAACAAGATTGG + Intronic
997582350 5:135025922-135025944 CAGCTTTGCCTGAAGAAGACGGG - Intergenic
999090873 5:148934751-148934773 CAATTTTGGCAGGAGAAGATTGG + Intronic
1003411868 6:5872021-5872043 CAGTGTGCCCAGAAGAGGAATGG - Intergenic
1003630911 6:7786275-7786297 CAGTGTTCCCAGTAGTAGAGAGG - Intronic
1003654103 6:7989423-7989445 CACTGTTGTCAGGAGAAGAAGGG + Intronic
1004351947 6:14897948-14897970 TAGTGTTTCCAGAAGAAGAAAGG - Intergenic
1004532884 6:16470361-16470383 CAGTTTTGCCAGAAAAAAAGAGG + Intronic
1005519603 6:26587948-26587970 CGGTTTTGCCAGTAAAAGATGGG - Intergenic
1006418591 6:33919669-33919691 GGGTGTTGCCTGAAGAAGTTGGG + Intergenic
1007394919 6:41572135-41572157 CAGTGTGGCCAAGAGAAGAGTGG - Intronic
1009974441 6:70657997-70658019 CAGTGCTGCTAGAAGAAGGGAGG + Intergenic
1011976938 6:93313452-93313474 AAGTGTTTCCTGAAGAAAATGGG - Intronic
1014779473 6:125547030-125547052 CAGTGCTACCAGTAGAAGACTGG - Intergenic
1015117251 6:129663349-129663371 CTGTGTTGTCAGAGCAAGATAGG - Intronic
1015195266 6:130518615-130518637 CAGTGTAGCCAGGAGCAGAAAGG - Intergenic
1017847613 6:158273134-158273156 CAGTGTTGCCAGTGAAAGTTAGG + Intronic
1017967485 6:159279082-159279104 CAGTGATACCAGGAGAAGGTTGG + Intergenic
1020933430 7:14429276-14429298 TAGTGGTGCCATAAGAAGAGAGG + Intronic
1021233120 7:18109437-18109459 CAGTGTTTCCTAAAGTAGATGGG + Intronic
1021423307 7:20470022-20470044 CAGTGTAGCCAGAGGAGGCTGGG - Intergenic
1021911970 7:25395169-25395191 CAGAATTGCCAGATGAAAATAGG + Intergenic
1022654256 7:32304406-32304428 CTGTGTGGCCAGGAGATGATGGG + Intergenic
1023034405 7:36118211-36118233 CAGTGTTCCCCAAAGAAGAAGGG - Intergenic
1024354774 7:48403291-48403313 CAGTGTGGTCAGAAGAAGCAAGG - Intronic
1025000063 7:55308531-55308553 CAGGGTTGCCAGACCATGATAGG - Intergenic
1029215130 7:98942479-98942501 CAGTGTTGTAAGAGGAAGACAGG - Intronic
1029818340 7:103120515-103120537 CAGTACTGCCAGAAGTAGACTGG + Intronic
1031100790 7:117478070-117478092 CACTCTTTCCAGAAGGAGATTGG + Intronic
1033590621 7:142805336-142805358 CAGTGTTACCTGAGGAAGAATGG - Intergenic
1037665580 8:20966857-20966879 CAGTGATGCCAGAAGCCGAGGGG + Intergenic
1045040509 8:98219461-98219483 CAGAGGTTCCAGAAGATGATGGG + Intronic
1045519564 8:102892036-102892058 CAGTGTTCTCAGATGAAAATGGG + Intronic
1047816971 8:128475284-128475306 CAGTGTTCCCAGAAGAAACCAGG + Intergenic
1053141599 9:35685921-35685943 CAGTCTGGGCAGAAGATGATTGG - Intronic
1055062280 9:72082250-72082272 CAGTTCTGCCAGAAAAAGAATGG - Intergenic
1056065971 9:82935038-82935060 CACTGGGGCCAGAAGAAGAATGG + Intergenic
1057955033 9:99400576-99400598 GAGTGTTGCCAGAAGTGGCTGGG + Intergenic
1059018277 9:110545759-110545781 CAGGGTTCCAAGAAGAAGAATGG - Intronic
1060031919 9:120221986-120222008 CAGTGCTCCCAGAGGAAGCTAGG - Intergenic
1060368188 9:123041644-123041666 CAGTGATGCCAGCAGAATTTTGG + Intronic
1060673653 9:125492940-125492962 CAGTGTTCCCAGATGATGAAAGG + Intronic
1060820287 9:126657986-126658008 CAGAGTTTCCAGAAGAGGCTGGG + Intronic
1187345182 X:18457548-18457570 CAGAGATGCTAGAAGAAAATGGG - Intronic
1187515733 X:19968331-19968353 CAGTGTTGCAAGATAGAGATAGG + Intronic
1188029959 X:25253247-25253269 CAGAGTTGGCAGAAGAAAAAAGG + Intergenic
1188818059 X:34739629-34739651 CAGAGTTGCCAGGAGAATAAAGG + Intergenic
1189494139 X:41493900-41493922 GAGTGGAGGCAGAAGAAGATTGG + Intergenic
1189754993 X:44262012-44262034 CAGGGTTGGAAGTAGAAGATGGG - Intronic
1190094571 X:47468405-47468427 CATCTTTGACAGAAGAAGATGGG - Intronic
1192102929 X:68284391-68284413 CAGTGGTGGCAGAAGAAGAAAGG - Intronic
1193762032 X:85478969-85478991 CAGCGTTTCCTGAAGAAGCTGGG - Intergenic
1194168819 X:90556530-90556552 CAGTGGGCTCAGAAGAAGATAGG + Intergenic
1197462486 X:126759604-126759626 CAGTGAAGCAAGATGAAGATTGG + Intergenic
1197530947 X:127625511-127625533 AATTGTTGCCACAAGAAAATAGG + Intergenic
1198167772 X:134074159-134074181 TAGTCTTGCCAGAAGAAGAAGGG - Intergenic
1200228548 X:154432595-154432617 CTGTGTGGCCAGAAGAGGAGGGG + Intronic
1200392478 X:155957895-155957917 CAGTGTTTCCTGAAAAAGAAAGG - Intergenic
1201331862 Y:12832167-12832189 CAGTTTTGCAAGATGAAGAGAGG + Intronic