ID: 916519135

View in Genome Browser
Species Human (GRCh38)
Location 1:165547537-165547559
Sequence AGGAAGAACCAGACTGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 186}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916519135 Original CRISPR AGGAAGAACCAGACTGATTA AGG (reversed) Intronic
900762982 1:4485407-4485429 GAGAAGAACCAGACTGAAGAAGG + Intergenic
902873880 1:19329557-19329579 AGGAAGAAGCAGAATGGTTAAGG + Intergenic
908563074 1:65326452-65326474 AGGAAGAAATAGAATGATAAAGG + Intronic
913128711 1:115817274-115817296 AGGAAGAACAAGATGGATTGAGG - Intergenic
913507981 1:119536270-119536292 ACAAAGAGCAAGACTGATTAGGG - Intergenic
914900492 1:151708852-151708874 CAGAAGAACCAAACTGCTTAGGG - Intronic
916271858 1:162952029-162952051 TGGAAGAACCAGAGTGGTAAAGG + Intergenic
916519135 1:165547537-165547559 AGGAAGAACCAGACTGATTAAGG - Intronic
917015658 1:170528778-170528800 AGGAAGAACCAGCCAGACAAGGG + Intergenic
917586553 1:176432947-176432969 AGGAATCACCAGCCTGATAAAGG - Intergenic
918393601 1:184091813-184091835 AGGAAGAAACAAACTTATTTTGG + Intergenic
920706312 1:208253097-208253119 AGAAAGAAAAAGAATGATTAAGG - Intergenic
924010948 1:239664801-239664823 AGGAAGACCCACACTGAGAACGG - Intronic
1064377873 10:14813377-14813399 AGGAGGAACAAGACTTATTGAGG + Intergenic
1065327653 10:24563515-24563537 AGGAACTCCCAGACTGATGATGG - Intergenic
1065387510 10:25148068-25148090 AGGAACAACCCGTCGGATTAGGG - Intergenic
1066806748 10:39263804-39263826 AGGAAGAATCATACTGAAAATGG + Intergenic
1067666950 10:48287258-48287280 GGGAAGAAACAGACTGTTTGGGG - Intergenic
1067948263 10:50705340-50705362 AGGAAGAACTTGACTGAGGATGG - Intergenic
1070508298 10:77137025-77137047 AGCAATGACCAGACAGATTAAGG + Intronic
1070883577 10:79870335-79870357 AGGAAGAACTTGACTGAGGATGG - Intergenic
1071650137 10:87386645-87386667 AGGAAGAACTTGACTGAGGATGG - Intergenic
1071817251 10:89245675-89245697 AGGAAGAACCATTCTGACAAAGG - Exonic
1073240075 10:102051563-102051585 GGACAGAACCAGACTGATTAAGG + Intronic
1073422399 10:103434771-103434793 TGGAAGAACCAACCTGATTCAGG - Intronic
1076459848 10:130634413-130634435 AGGAACAACCAGACCTATGATGG - Intergenic
1081052460 11:38361584-38361606 AGGAAGACCCACACACATTATGG + Intergenic
1081711574 11:45219859-45219881 GGGAAGACCCAGAGTGATTCGGG + Intronic
1081837033 11:46164439-46164461 CGGAAAAACAAGAGTGATTAAGG + Intergenic
1081890161 11:46534622-46534644 AGGAAGAACCAAACTCATCCAGG + Intronic
1083481797 11:62953335-62953357 TGGAATGACCAGAATGATTAGGG + Intronic
1083758025 11:64801837-64801859 AGGAAGAAGCAGCCTGAGTGGGG - Intronic
1083872406 11:65497336-65497358 AGGAAGACCTAGACTGAAAATGG + Intergenic
1085583879 11:77681994-77682016 AGGAAAAACCATAGAGATTATGG - Intronic
1086378996 11:86232195-86232217 AGGAAGAAACAGATTTAATAAGG - Intergenic
1087654671 11:100907769-100907791 AGGAAGAAGAAGTCTAATTAGGG + Intronic
1090678486 11:129027976-129027998 GGCAAGAAAAAGACTGATTAGGG + Intronic
1092901155 12:13060515-13060537 AGGAAGAACCACACAGGATAGGG + Intronic
1093537932 12:20244996-20245018 AGGAAGAACTAGAATAATTCTGG + Intergenic
1094355127 12:29569441-29569463 AGCAAGAAAGAGAGTGATTAGGG - Intronic
1095527960 12:43150509-43150531 AGGCAGAACCAGGCTGATCTTGG + Intergenic
1095731947 12:45515742-45515764 AGGAACAACCAGACATATTTGGG - Intergenic
1098609827 12:72442698-72442720 GGGAAGAGCCAGACTGTTCAGGG - Intronic
1098820818 12:75226497-75226519 TGGAAAAAACAGACTTATTAGGG - Intergenic
1101090303 12:101278608-101278630 AGGTAGAAACAGACTAGTTATGG - Intergenic
1101606302 12:106249163-106249185 AGAAAGAAGCAGACTGAGTGAGG - Intronic
1102411365 12:112722473-112722495 ATGAAGAAGTAGACTGAATATGG - Intronic
1104747694 12:131220347-131220369 AGGAAGAAACAGAGACATTAAGG - Intergenic
1105408188 13:20148944-20148966 AGGCAGAACCAAAAAGATTAAGG - Intronic
1105958788 13:25310054-25310076 AGGAAGAACCTGTCTGATAGGGG - Intronic
1106844600 13:33724791-33724813 AGAAAGAACATGACTAATTAAGG + Intergenic
1107609898 13:42102614-42102636 AGGAAGGAGCTGACTGATTCAGG + Intronic
1107756539 13:43629461-43629483 AGGAGGAAGTAGACTGGTTAAGG - Intronic
1108371330 13:49772216-49772238 AGGAAGAACAACAATGAATACGG + Intronic
1111613061 13:90629497-90629519 AGGAAGAAACATACAGATAATGG + Intergenic
1116363217 14:44027920-44027942 AGCAAGAACTAGACTGGTGATGG - Intergenic
1116931198 14:50693035-50693057 AAGAAGAACCAAACAAATTATGG - Intergenic
1118545428 14:66882044-66882066 AGGAAGAACCAATCTAATGATGG - Intronic
1120212892 14:81651642-81651664 GGGAAGCAGCAGACTGATTCTGG - Intergenic
1120606052 14:86579908-86579930 AGGATGAACAAGACTGTTTAGGG - Intergenic
1121591986 14:95122193-95122215 AGGAAGTAACCGACTGATTCTGG + Intronic
1121822583 14:96983360-96983382 AAGAAAAACAAAACTGATTAGGG + Intergenic
1122118630 14:99540347-99540369 AGGAAGAACAAGAGTGATCTGGG + Intronic
1122512774 14:102283211-102283233 AGGAACATACAGACTGTTTAAGG + Intronic
1128460011 15:67859878-67859900 AGGAAGAGCCAGGCTGGTAAAGG + Intergenic
1131482937 15:92797660-92797682 AGGAAGAAGCAGCCTGATGCGGG + Intronic
1131665289 15:94565183-94565205 AGAAAGAACCAGTCTTATCAGGG + Intergenic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133492753 16:6286581-6286603 AGTAACAACCACACTTATTAAGG - Intronic
1133585332 16:7189087-7189109 AGGAAGACCTACACTGATTCAGG + Intronic
1133585391 16:7189476-7189498 AGGGAGACCCACACTGATTCAGG + Intronic
1134204456 16:12225771-12225793 AGGAAGAACAAGACTTGTTTGGG - Intronic
1137889371 16:52142596-52142618 AGAAAAAACCAGATTGATGAGGG + Intergenic
1139630489 16:68229261-68229283 AGGAACACTCAGACAGATTAAGG - Exonic
1140016653 16:71193452-71193474 AAGGAGAACCAGACAGAATAGGG + Intronic
1140429394 16:74888680-74888702 AGGAAGAATCACACTGCTTTTGG + Intronic
1140571174 16:76107990-76108012 AGGAAGAAACAAACTGATGTGGG + Intergenic
1148810862 17:50290223-50290245 AGCAAGGACCAGTCTGATTCAGG - Intergenic
1153940876 18:9975639-9975661 AGGAAGCACAAGACTGCTCAAGG - Intergenic
1156129379 18:33951950-33951972 ATGTAGAACCAGACAGATTAGGG - Intronic
1156452817 18:37276072-37276094 AGGAAGAGCCAGACCGAGGAGGG - Intronic
1159876607 18:73818781-73818803 AGGAAGATCCTGACAGTTTAAGG - Intergenic
1161349294 19:3783450-3783472 AGGTAGAACCAGGCTGACTCAGG + Intronic
1162233247 19:9284272-9284294 ATGAGGAACCAAACTGATCAGGG - Intergenic
1163095400 19:15053700-15053722 AGGAAGAACCAGACTCAGCTGGG - Intronic
1163785187 19:19271295-19271317 AGGAAGAAACAGCCTGAGCAAGG - Intronic
1165433212 19:35783974-35783996 AGGAAGAACCACACTGAGATGGG + Intronic
1166931806 19:46305522-46305544 AGGAAGACCCAGAATGGTCAGGG + Intronic
1167078754 19:47265004-47265026 AGCAGGAACCAGACAGATCAGGG + Intronic
926872506 2:17438460-17438482 AGGTAGGACCAGATTGATAAAGG - Intergenic
928706949 2:33960232-33960254 AGGAAAAACAAGAGCGATTAAGG + Intergenic
930517269 2:52423853-52423875 AGGAACAACCAGAGTTACTATGG - Intergenic
933593520 2:84259794-84259816 AGGAATAGACAGACTGATTAAGG - Intergenic
937043569 2:118838791-118838813 AGGAAAAACCAGGCTGACCATGG + Intergenic
937219602 2:120334668-120334690 AAGGAGAAGCAGACTGGTTAGGG - Intergenic
943489523 2:188533230-188533252 AGGAAAAACCAAAGTGAATAGGG + Intronic
945325438 2:208476852-208476874 GGGAAGATCCTGACTAATTATGG - Intronic
945461096 2:210109750-210109772 AGAAAGAAGCAGGCTGATTCAGG - Intronic
946511999 2:220367911-220367933 AGGATGAAAAAGTCTGATTATGG - Intergenic
946847180 2:223869785-223869807 AGGAACAAGGAGACTGGTTAGGG + Intronic
947250809 2:228101259-228101281 AGGAATAACTACAATGATTATGG - Intronic
1170854392 20:20037324-20037346 AGAAAGGTCCAGACTGATGATGG - Exonic
1175303921 20:57963035-57963057 AGGACCAAACAGAATGATTACGG - Intergenic
1178176642 21:30107541-30107563 AGGAGGCAGCAGAATGATTATGG + Intergenic
1179463370 21:41553163-41553185 AAGAAGAACCAGCCTGCTTTGGG + Intergenic
1182249109 22:28985402-28985424 AGGAAGAGTTAGACTGATCAGGG - Intronic
1184014148 22:41772943-41772965 AGGAAGACCCAGGCTGAGAAAGG - Intronic
949317262 3:2770494-2770516 TGGTAGAGCCAGACTGATGAGGG - Intronic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
950435033 3:12974398-12974420 AGGAGCAGCCAGACTGATGAGGG - Intronic
952035884 3:29200407-29200429 AGGAAGTTCCAGACTAATAAAGG - Intergenic
952678059 3:36056975-36056997 AGCAAGAACGAGACAGATTCAGG - Intergenic
953811237 3:46114636-46114658 AGGAAGAATTAGACAGACTAGGG - Intergenic
957444913 3:80303522-80303544 AGGAAGAAACAGAGAGATAATGG - Intergenic
958198916 3:90281498-90281520 AGGAGGAGCCAGATTCATTAAGG + Intergenic
962082934 3:132159760-132159782 GGGAAGAAACAGAAAGATTAGGG + Intronic
964475392 3:157093120-157093142 GTGAAGGACCAGACTGGTTATGG + Intergenic
964550348 3:157878241-157878263 AGAAAGAATCAGAATGATCAAGG + Intergenic
964575632 3:158163718-158163740 AGGTAGAAACAGATTGATTTTGG - Intronic
966884618 3:184369778-184369800 GGGACCAACCAGACTGATTTGGG + Intronic
967043922 3:185719064-185719086 AGGAAGAAACAGACTGTGTTTGG + Intronic
967337140 3:188357146-188357168 AAGAAGAACAAAAATGATTAAGG + Intronic
967477958 3:189942781-189942803 AGGAAGAACAAGGCTCATTCTGG + Intergenic
968735907 4:2296530-2296552 AGGAAAAACAAGAATGATTGAGG - Intronic
969882863 4:10189676-10189698 AGGAGTAAGCAGACTGATTCTGG + Intergenic
970028671 4:11653003-11653025 AGGATGAACTAGACTGAATTAGG + Intergenic
970076742 4:12230795-12230817 AGGATGAAACAGAGTTATTAAGG - Intergenic
971907345 4:32743553-32743575 AGCAGGAACCAGAGTGATCAGGG - Intergenic
972270940 4:37510431-37510453 AGGAAGAACCACAGTGATCCTGG - Intronic
977366462 4:96075160-96075182 AGGAGGAACCAGAGTGACCATGG - Intergenic
977483931 4:97617630-97617652 GTGAAGAACCAGACAGAATAAGG + Intronic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
979795239 4:124838101-124838123 ACTAATAACCAGACTGATAATGG - Intergenic
979911434 4:126371634-126371656 AGGAAGTACCAGACTGAGAGTGG + Intergenic
982160872 4:152568205-152568227 AGAAAGAATCAGACTTATGAAGG - Intergenic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
984771567 4:183441131-183441153 AGGTAGTAACAGTCTGATTACGG - Intergenic
985149609 4:186932983-186933005 AGCATGAAGTAGACTGATTAGGG - Intergenic
985472905 5:56990-57012 AAGAAGACTCAGACTGAATAGGG + Intergenic
986395635 5:7326924-7326946 AGGAAGAACCAAACTGGTGATGG + Intergenic
987263431 5:16226942-16226964 AGGAAGAAAGATACTGATGAAGG + Intergenic
987482854 5:18480463-18480485 AGGAACACCCAGACTGCCTAGGG - Intergenic
988000914 5:25347167-25347189 AGGAAGAAAGAGAATGATGAAGG - Intergenic
989199460 5:38749275-38749297 GGGCAGAACCAGACTGAGTTTGG + Intergenic
989506370 5:42230920-42230942 AGGAAGGAGCAAAGTGATTAAGG - Intergenic
990821383 5:59844597-59844619 AGGAAGAACCAGATATATGAAGG - Intronic
992211032 5:74479682-74479704 AGGAAGAATCAGCGTGATCAGGG + Intergenic
992868533 5:80982449-80982471 AGGAAGAACTAGGCTCATTTTGG + Intronic
995888692 5:116924587-116924609 AGAAACAGCCAGGCTGATTATGG - Intergenic
996235404 5:121123516-121123538 AGGAAGAACCAGACACATAGAGG - Intergenic
998936831 5:147237763-147237785 AGGCAGACTCAGACTCATTAAGG - Intronic
1002130988 5:177081626-177081648 AGAAAGAACAAGACTGGGTAGGG + Intergenic
1004572097 6:16856683-16856705 AGCAAGACCCAGAGTGGTTAAGG + Intergenic
1008338001 6:50329586-50329608 TGGAAGAACCAGGCAGAATAAGG - Intergenic
1009819169 6:68777494-68777516 AGTAATAACCAGAATGATCAGGG + Intronic
1010231430 6:73538765-73538787 AGCAAGGACCAGACAGATAATGG + Intergenic
1014134499 6:117872908-117872930 AGTAGGAACCAGACTAATTGAGG - Intergenic
1014786878 6:125629684-125629706 AGGAAAAATTAGACAGATTATGG - Intergenic
1015955103 6:138590467-138590489 AGGAAGAACCAGAGGGAAGAGGG - Intronic
1016239120 6:141907931-141907953 AGTAAGAACCATATGGATTATGG - Intergenic
1016348432 6:143141216-143141238 AGAAAGAAAGAGACTGATAATGG - Intronic
1018223228 6:161602916-161602938 AGTAAGAGGCAGACTGATAATGG + Intronic
1021239926 7:18187850-18187872 AGGAAGAAGCACACTGAAGAAGG - Intronic
1022893118 7:34721134-34721156 AGAAAGAACAAGAATGATCAAGG + Intronic
1024048609 7:45602029-45602051 GGGAAGAACAAGAGTGATCAGGG + Intronic
1024925135 7:54604598-54604620 ACGAATAAACAGGCTGATTAAGG - Intergenic
1025115399 7:56253944-56253966 AAAAAAAAGCAGACTGATTAAGG + Intergenic
1030293437 7:107894746-107894768 AGGGATCACCAAACTGATTATGG - Intronic
1030527467 7:110671846-110671868 AGGAAGAACAAGACTGTTAGCGG + Intronic
1036177665 8:6554700-6554722 AGGGAGAACCAGTCTGATTTTGG + Intronic
1036383830 8:8260633-8260655 AAAAAGAAACAGGCTGATTACGG + Intergenic
1038037758 8:23701104-23701126 AGTGAGAAGCAGACTGCTTAAGG - Intergenic
1038358733 8:26856461-26856483 GGGAAGAACCAGACTAAACAAGG - Intronic
1042731999 8:71946426-71946448 AGGAGAAACCAGACTGAATTGGG - Intronic
1044121688 8:88404679-88404701 AGGAATAGCCAGAAAGATTATGG - Intergenic
1044203405 8:89462976-89462998 AAGAAGAACCAGACTGTCTAAGG - Intergenic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1047096231 8:121629041-121629063 AAGAAGATCCAGACTACTTAAGG - Exonic
1047843436 8:128779424-128779446 AGGTAGACACAGACTGATAATGG - Intergenic
1048604873 8:135957014-135957036 AGGAAGAACCAGGCAGAGAAAGG + Intergenic
1053475916 9:38382017-38382039 AGGTAGAAGCAGACAGATCAGGG - Intergenic
1053556119 9:39138676-39138698 AGGAAGACCCAGACAGAGAAGGG - Intronic
1054110513 9:61102615-61102637 AGGAAGACCCAGACAGAGAAGGG - Intergenic
1054610344 9:67228510-67228532 AGGAAGACCCAGACAGAGAAGGG + Intergenic
1057588258 9:96348706-96348728 AGGAAGAGCCAGGCTGAGCATGG + Intronic
1059228603 9:112696433-112696455 AGGAAAAACCAAACTGTTTTTGG + Intronic
1060997394 9:127882910-127882932 AGGAAGCACCAGCCTCACTAAGG + Intergenic
1186777872 X:12883631-12883653 AGCAAGAAACTGACTGATTAAGG + Intronic
1188115415 X:26237558-26237580 TGAAAGAACCAGGCTGATGAAGG - Intergenic
1188464184 X:30460275-30460297 AGGAAGAACCTGAATGTTTATGG - Intergenic
1191818333 X:65274084-65274106 AGGAAGATCCAGTCTGAGTGGGG - Intergenic
1194033977 X:88848282-88848304 CGGAAGAACCAGAGTAATAATGG - Intergenic
1194467868 X:94255540-94255562 AGGAAGGAGCAGAGAGATTAAGG + Intergenic
1194751479 X:97689561-97689583 AGGATGAACCAGACTCAGAATGG + Intergenic
1198209665 X:134505376-134505398 AGGAAGACCCAGACAGAGAAGGG - Intronic
1199435592 X:147809088-147809110 CAGAAGCTCCAGACTGATTAGGG - Intergenic