ID: 916519586

View in Genome Browser
Species Human (GRCh38)
Location 1:165551839-165551861
Sequence TGGATGACTTTGTACTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916519586_916519589 4 Left 916519586 1:165551839-165551861 CCTACCAAGTACAAAGTCATCCA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 916519589 1:165551866-165551888 TGTGCCCAAACTTAGATTTCCGG 0: 1
1: 0
2: 1
3: 15
4: 124
916519586_916519592 16 Left 916519586 1:165551839-165551861 CCTACCAAGTACAAAGTCATCCA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 916519592 1:165551878-165551900 TAGATTTCCGGAATGAATTCAGG 0: 1
1: 0
2: 1
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916519586 Original CRISPR TGGATGACTTTGTACTTGGT AGG (reversed) Intronic
901164587 1:7208952-7208974 TGGTTGACTCTGTCCTGGGTGGG + Intronic
902077046 1:13795638-13795660 TGGATGTCTTTGTTCTTCCTGGG + Intronic
907074285 1:51564636-51564658 TGAATGACTGTGAATTTGGTGGG - Intergenic
907276981 1:53322109-53322131 TGGGTGAGGTTGTTCTTGGTGGG - Intronic
907628948 1:56060785-56060807 TGGATAGCTATGTAGTTGGTGGG - Intergenic
915247258 1:154565253-154565275 TGGCTGCCTTTCTTCTTGGTGGG + Intergenic
916008306 1:160681530-160681552 TGGATCCCTTTGTTCTTTGTTGG - Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916519586 1:165551839-165551861 TGGATGACTTTGTACTTGGTAGG - Intronic
917303309 1:173601884-173601906 TGGATGAATTGGATCTTGGTAGG - Intronic
920768817 1:208859914-208859936 TTGTTGACTTTGTACATAGTTGG + Intergenic
920989553 1:210923650-210923672 TGGAGGAGTTGGTGCTTGGTTGG - Intronic
921958862 1:221013079-221013101 TGGATGACATTGAAGTTGGGTGG - Intergenic
924642319 1:245845989-245846011 TGGATGGCTTTGGCCTTTGTGGG - Intronic
1062910786 10:1210733-1210755 TGGAGCACTTTGTACCTCGTGGG + Intronic
1066448388 10:35505110-35505132 TGGGTGACATTGTAGGTGGTTGG + Intronic
1071505261 10:86228114-86228136 TGGATGAATATGTAGGTGGTTGG + Intronic
1075180290 10:120204895-120204917 TGGTTGACTTTGTATTTGTCTGG + Intergenic
1076452453 10:130566086-130566108 TGTTTTGCTTTGTACTTGGTCGG - Intergenic
1076982870 11:214222-214244 TGGATGACTCTGTTCCTGTTGGG - Exonic
1080805019 11:35644944-35644966 GGGATGACTTGGTTCTTTGTGGG + Intergenic
1084413353 11:69016516-69016538 TGGATGGTCTTGTACTTGGATGG - Intergenic
1085016332 11:73176551-73176573 TGCAAGACTTTGCACTTGGATGG - Intergenic
1085464283 11:76713532-76713554 TGGGTGAGTGGGTACTTGGTGGG + Intergenic
1086509021 11:87536037-87536059 TGTATGATTTTGAACTTGGTTGG + Intergenic
1088711308 11:112511398-112511420 TGGATTACCTTCTACTTGATGGG + Intergenic
1089773575 11:120820343-120820365 TGGATGCATTTGTACTTGATGGG + Intronic
1091435837 12:472228-472250 TTGCTGAGTTTGGACTTGGTAGG + Intronic
1092095292 12:5837171-5837193 TGGGTGCCTTTGCACTTGGTAGG - Intronic
1095234635 12:39782029-39782051 TAGATGGGCTTGTACTTGGTGGG + Intronic
1095359533 12:41319642-41319664 TGGCTGATTTTGGAATTGGTGGG - Intronic
1095494916 12:42773918-42773940 TATATGACTTTGTACTTGTTTGG + Intergenic
1096273562 12:50186312-50186334 TGTTTAACTTTCTACTTGGTAGG - Intronic
1098225534 12:68318350-68318372 TGGATGACTGTGTACATGGAGGG - Intronic
1100780784 12:98023837-98023859 TGGATGACTCTTTTCTTGGATGG - Intergenic
1104331794 12:127853778-127853800 TGGATGCTTCTGTGCTTGGTTGG - Intergenic
1104925836 12:132313570-132313592 TGGATGGCTGGGTACTTGGGTGG - Intronic
1105800321 13:23897174-23897196 AGGATGACATTGTCCTTGGAAGG + Intronic
1107197732 13:37673592-37673614 GGGATTATTTTGTACTTTGTTGG - Intronic
1114261460 14:21039589-21039611 TGCTTCACCTTGTACTTGGTAGG - Intronic
1117592032 14:57280337-57280359 TGGATGACTCTGCATTTAGTGGG + Exonic
1118974003 14:70661861-70661883 TGGAGGAATCTGTACTTGGGAGG + Intronic
1120394767 14:83955149-83955171 TGGATGACTGGGTAAGTGGTAGG + Intergenic
1121374071 14:93389610-93389632 TGGAAGAATTTGTATTAGGTTGG - Intronic
1126446761 15:48755298-48755320 TCAATACCTTTGTACTTGGTTGG + Intronic
1132216624 15:100067662-100067684 TGGATGACTTTGTGCTTCCCAGG + Intronic
1134642243 16:15838373-15838395 TGCAGGTCTTTGTACTTGGTGGG - Intronic
1138506036 16:57478744-57478766 TGGGTGACTCTGTGCTTGCTTGG - Intronic
1140975137 16:80052756-80052778 AGCATGGCTTTGTACTTGGATGG - Intergenic
1141055021 16:80805534-80805556 TGGATCATTTTCTACTTGGGAGG + Intergenic
1142813954 17:2410975-2410997 TGGAAGACTTTACACCTGGTGGG + Intronic
1143583633 17:7840353-7840375 TGGAGGAATTTTTTCTTGGTAGG + Intronic
1145163405 17:20590328-20590350 GGGATGAGTTTGAACTTGGAAGG + Intergenic
1146091596 17:29884677-29884699 TTGAAGACTTTGAGCTTGGTTGG - Intronic
1146540715 17:33691662-33691684 AGCATGACTTTGTTCATGGTGGG + Intronic
1154057599 18:11026298-11026320 TGGCTCACTTTGTACTTGTTCGG - Intronic
1158088005 18:53676463-53676485 AGGCTGTCTTTTTACTTGGTTGG + Intergenic
1162104214 19:8360397-8360419 AGGATGACTTTGTCTTTGCTGGG + Intronic
1163702682 19:18794062-18794084 TGGAGGAGTTTGTACGAGGTGGG - Intergenic
1164903092 19:31944814-31944836 TGTGTGACTTTGTAGTTTGTTGG - Intergenic
1167101419 19:47406496-47406518 GGGATGAGTTTGAACTTGGAAGG - Exonic
1168443885 19:56395275-56395297 TGGCTGGCTTTGTACCTGTTTGG - Intergenic
1168579793 19:57545493-57545515 GTGATCACTTTGTACTTGCTTGG - Intronic
926424434 2:12728268-12728290 TGGCTGACTGTGTGCTAGGTAGG - Intronic
928393790 2:30929037-30929059 TGGATGACCTAGAACTTGGAGGG + Intronic
933456342 2:82524664-82524686 TGGATGATTTTGTACATCCTTGG - Intergenic
938648626 2:133356694-133356716 TGAATGACTTTCTTCTTGTTGGG - Intronic
940173450 2:150852813-150852835 TGGATTACTTTGTTCATGGTTGG - Intergenic
942477521 2:176343697-176343719 TGGTTGATTTTATTCTTGGTTGG + Intergenic
943429411 2:187779261-187779283 TGGAAGACTTTGTAGTTGTGTGG + Intergenic
944629144 2:201605522-201605544 TGGATGAAGTTGTAATTGATGGG - Intronic
945996446 2:216440771-216440793 TGGATGACTCTGTTGTTGGGGGG + Intronic
946228065 2:218275295-218275317 TGGATGTGTGGGTACTTGGTGGG - Exonic
948411577 2:237766629-237766651 TTGATCACTTTGTACATGGAAGG + Intronic
948661667 2:239510903-239510925 TGGAAGACTTTGTCATTCGTAGG - Intergenic
1178472245 21:32904034-32904056 TGAATGACTTTGTCCTTTTTGGG - Intergenic
1178881505 21:36453800-36453822 TGGATGACCTTGAACCTGGATGG - Intergenic
1179334953 21:40442051-40442073 TGGATGAAGTTGTAATTGTTTGG - Intronic
1180022156 21:45135202-45135224 TGGAGGACTGTGTGCTGGGTAGG + Intronic
951672053 3:25195377-25195399 TTGATGACATTGGATTTGGTTGG + Intronic
952294148 3:32046673-32046695 TGGATGAATTGGTGGTTGGTTGG - Intronic
955300758 3:57776175-57776197 TGGTTGTCTTTGGAGTTGGTTGG + Intronic
956417771 3:69051678-69051700 TGGATGACAGGGGACTTGGTTGG - Intronic
957237552 3:77614172-77614194 TAGATGAATTTGTAAGTGGTGGG + Intronic
960572169 3:119196047-119196069 ATGATGAATTTGTAGTTGGTAGG - Intronic
961186072 3:124916115-124916137 TTGATGACTTGGGACATGGTTGG + Intronic
967204588 3:187107960-187107982 TGGATGATATAGTACGTGGTAGG + Intergenic
967592573 3:191295800-191295822 TTGATGACTTTGTGATTGATTGG - Intronic
968809892 4:2795059-2795081 TGAAGCACTTTGTACCTGGTGGG + Intronic
970346092 4:15153607-15153629 TGGTTGAGTTTGTAGATGGTGGG - Intergenic
970836750 4:20418132-20418154 TGGATGACTCTGTACATAGGAGG + Intronic
978653798 4:111042025-111042047 TGGATGACTTTAAACTTCATGGG + Intergenic
983361401 4:166727765-166727787 TGAATGATTTTGTACAAGGTTGG - Intergenic
984209751 4:176831687-176831709 TGCATTACTTTTTTCTTGGTTGG - Intergenic
992179185 5:74180255-74180277 TGGGTGACTTTTTAACTGGTTGG - Intergenic
995563757 5:113411589-113411611 TGGGTGACATTGTAGGTGGTTGG - Intronic
998545738 5:143025977-143025999 TAGATGCCTTTGTATCTGGTAGG + Intronic
1000114968 5:158145454-158145476 AGGATGACTCTGTACTTGACTGG + Intergenic
1001735899 5:174000898-174000920 TGCATAACTTTGAACTTGTTGGG + Intronic
1005884850 6:30089564-30089586 TGGATGACTGTGTAATTGCAAGG + Intergenic
1014710197 6:124797501-124797523 TTGATGCATTTGTGCTTGGTTGG - Intronic
1016040453 6:139427222-139427244 TTGAAGAGTTTGTACCTGGTTGG - Intergenic
1018097783 6:160407174-160407196 TGGATGACTTGCTACGTGATTGG + Exonic
1020783387 7:12543480-12543502 TGGATGACTTTGATTTTTGTGGG - Intergenic
1022647273 7:32243021-32243043 TGGATGACCTTGGCCTTGCTGGG + Intronic
1025858726 7:65306797-65306819 TGCATGAATTTGTACTTGCATGG - Intergenic
1028718547 7:94002894-94002916 TAGATCACTGTGTACTTTGTGGG - Intronic
1029018584 7:97340209-97340231 TGTGTGCCTTTGTTCTTGGTTGG - Intergenic
1029172076 7:98637863-98637885 TGGATGACTCTGTAAGGGGTTGG + Intergenic
1029284476 7:99456331-99456353 TGGATGATTTGGGATTTGGTGGG + Intronic
1030172039 7:106612646-106612668 TGGATGCCTTTGGACTTCTTTGG + Intergenic
1032133711 7:129254536-129254558 TGAATTATTTTGTACTTGATTGG + Intronic
1032681330 7:134186932-134186954 TGAATGAGTTTGTAGTTGGGAGG - Intronic
1038720640 8:30032492-30032514 GGGATGATTTGGTACTTGATGGG - Intergenic
1039620568 8:38993505-38993527 TGGAGTAGTTGGTACTTGGTTGG - Intronic
1044229140 8:89755688-89755710 TGTAGGTCTTTTTACTTGGTGGG + Intergenic
1044299916 8:90571939-90571961 TGGAGGCCTTTGTAATTGCTTGG - Intergenic
1046073831 8:109292193-109292215 TGGATGCTTTTGTACTGTGTTGG + Intronic
1046131719 8:109974781-109974803 TGAATGACTCGCTACTTGGTGGG + Exonic
1046209321 8:111046754-111046776 TGCATGACTTGCTACTTGATAGG + Intergenic
1052431243 9:28369307-28369329 TTGATTACTTTGTCCTTGGGGGG + Intronic
1054323767 9:63702990-63703012 TGGAGGCCGTTGTCCTTGGTTGG + Intergenic
1059525932 9:114991002-114991024 TGGATGACTTTGTAAAAGGAGGG - Intergenic
1059648099 9:116287221-116287243 TGGATGACTTTCTCCATGCTGGG - Intronic
1059680746 9:116583135-116583157 TGCATGACTATGTACTTCCTGGG - Intronic
1186372151 X:8958245-8958267 TGGATGATATAGTACTTGCTGGG + Intergenic
1188303090 X:28529527-28529549 TGGATTAGTTTGCACTTGATAGG + Intergenic
1191802528 X:65097169-65097191 TAGATGAATTTGTAATTAGTAGG - Intergenic
1193135893 X:77970216-77970238 TGTATGTCTTCATACTTGGTAGG + Intronic
1196382568 X:115108129-115108151 TGGATGACTTTCTACTTGTAGGG + Intergenic
1200407592 Y:2829280-2829302 TGGATAACTTTATACTTTGGTGG - Intergenic
1200648451 Y:5813401-5813423 TGGATTACATTGTACTTGAAGGG + Intergenic