ID: 916521870

View in Genome Browser
Species Human (GRCh38)
Location 1:165570569-165570591
Sequence ACTGAGATGTTCAGCAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916521866_916521870 5 Left 916521866 1:165570541-165570563 CCTGTTTCACTGGCTAGTCCCCA No data
Right 916521870 1:165570569-165570591 ACTGAGATGTTCAGCAACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916521870 Original CRISPR ACTGAGATGTTCAGCAACCC AGG Intergenic
No off target data available for this crispr